View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15931_high_30 (Length: 237)
Name: NF15931_high_30
Description: NF15931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15931_high_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 6551646 - 6551872
Alignment:
| Q |
1 |
acatcgtttgtgatagcaatggcgatgacatagatgaactagaccttttcagtagcaatggaggttttgatcttggagacgttgaaaatccatcctctat |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6551646 |
acatcatttgtgatagcaatggcgatgacatagatgaactagaccttttcagtagcaatggaggttttgatcttggagacgttgaaaatccatcctctat |
6551745 |
T |
|
| Q |
101 |
tgaaaggaattctgaaatcatcagtggagttcgtaatagctcaatcgccggagaaaactcttatggcgaacacccttctagaacattatttgtgagaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6551746 |
tgaaaggaattctgaaatcatcagtggagttcgtaatagctcaatcgccggagaaaactcttatggcgaacacccttctagaacattatttgtgagaaat |
6551845 |
T |
|
| Q |
201 |
attgatagtgatgttaaagattctgtg |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
6551846 |
attgatagtgatgttaaagattctgtg |
6551872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 131 - 225
Target Start/End: Complemental strand, 49061200 - 49061106
Alignment:
| Q |
131 |
tcgtaatagctcaatcgccggagaaaactcttatggcgaacacccttctagaacattatttgtgagaaatattgatagtgatgttaaagattctg |
225 |
Q |
| |
|
|||||| | |||| |||||| ||||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
49061200 |
tcgtaacacctcattcgccgtagaaaacccttctggtgaacacccttctagaacattatttgtgagaaatattgatagtgaggttgaagattctg |
49061106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University