View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15931_low_30 (Length: 246)
Name: NF15931_low_30
Description: NF15931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15931_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 22 - 230
Target Start/End: Complemental strand, 29645530 - 29645323
Alignment:
| Q |
22 |
tagaaagtgtattaatagaattctcaaacaggttttgttttgcttaccatcctctgcagtgagtactcccttcacaagaattggaaggctagtgatagtc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29645530 |
tagaaagtgtattaatagaattctcaaacaggttttgttttgcttaccatcctctgcagtgagtactcccttcacaagaattggaaggctagtgatagtc |
29645431 |
T |
 |
| Q |
122 |
tgaagccacttcacatcctgcacaaaagtaacaaagacaactcaatatcattcgtacctcgaaagaagcattgatatacactaaaagtcacagaaccaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29645430 |
tgaagccacttcacatcctgcacaaaagtaac-aagacaactcaatatcattcgtacctcgaaagaagcattgatatacactaaaagtcacagaaccaaa |
29645332 |
T |
 |
| Q |
222 |
attaaactt |
230 |
Q |
| |
|
||||||||| |
|
|
| T |
29645331 |
attaaactt |
29645323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University