View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15931_low_32 (Length: 244)
Name: NF15931_low_32
Description: NF15931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15931_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 24632031 - 24632260
Alignment:
| Q |
1 |
cctgagttatctctctttctggctttatcatattgtggttcaaaaactagtatctcatgtcccttttagtcctgctaattgttgtcagctagaacttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24632031 |
cctgagttatctctctttctggctttatcatattgtggttcaaaaactagtatctcatgtcccttttagtcctgctaattgttgtcagctagaacttgtt |
24632130 |
T |
 |
| Q |
101 |
catcagggttttgatttaaatggattagaacatgagaataaaatttgaaaagataggtgctggaactatttgaggataaaattagaggtttcccataatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24632131 |
catcagggttttgatttaaatggattagaacatgagaataaaatttgaaaagataggtgctggaactatttgaggataaaattagaggtttcccataatt |
24632230 |
T |
 |
| Q |
201 |
aaagttcctgcaaaaaataaatgagtataa |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24632231 |
aaagttcctgcaaaaaataaatgagtataa |
24632260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 230
Target Start/End: Original strand, 24685554 - 24685599
Alignment:
| Q |
185 |
gaggtttcccataattaaagttcctgcaaaaaataaatgagtataa |
230 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24685554 |
gagggttcccataattaaagttcctgcaaaaaataaatgactataa |
24685599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 117
Target Start/End: Original strand, 24685432 - 24685532
Alignment:
| Q |
17 |
ttctggctttatcatattgtggttcaaaaactagtatctcatgtcccttttagtcctgctaattgttgtcagctagaacttgttcatcagggttttgatt |
116 |
Q |
| |
|
|||||| |||||||| | ||||| || |||||||||| |||||| |||||| | || || |||||||||||||||| || | | ||||| |||||| ||| |
|
|
| T |
24685432 |
ttctggttttatcatctcgtggtccagaaactagtatgtcatgttccttttggaccagcaaattgttgtcagctaggacctctccatcaaggttttcatt |
24685531 |
T |
 |
| Q |
117 |
t |
117 |
Q |
| |
|
| |
|
|
| T |
24685532 |
t |
24685532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University