View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15931_low_37 (Length: 226)
Name: NF15931_low_37
Description: NF15931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15931_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 12 - 193
Target Start/End: Original strand, 37691466 - 37691662
Alignment:
| Q |
12 |
cgaagaaaatatgatggcaggcgcgagatacatgtcaagggttagggaactagggaagtatgagaaacaatgtaca---------------tgattctct |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37691466 |
cgaagaaaatatgatggcaggcgcgagatacatgtgaggggttagggaactagggaagtatgagaaacaatgtacatcatcatcaattacatgattctct |
37691565 |
T |
 |
| Q |
97 |
agttttccagagtgtgtaagggaccagttagaaaagagccaattattcttgtgagtggtagtcatcaagttggtaaaaagagaagtactcataataa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
37691566 |
agttttccagagtgtgtaagggaccagttagaaaagagccaattattcttgtgagtggtagtcatcaagttggtaaaaagagaagtcctaataataa |
37691662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University