View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15931_low_40 (Length: 203)
Name: NF15931_low_40
Description: NF15931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15931_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 20 - 193
Target Start/End: Complemental strand, 7562792 - 7562619
Alignment:
| Q |
20 |
cctgaaggtggtggcggtggcggtgatcctgaaggagacggctgggaatctgaaggtggtgatggtggtggtgattgtggtgactcttctggtggagaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7562792 |
cctgaaggtggtggcggtggcggtgatcctgaaggagacggctgggaatctgaaggtggtgatggtggtggtgattgtggtgactcttctggtggagaat |
7562693 |
T |
 |
| Q |
120 |
ctgaaggcgtcgaagaagagttatcagaatcaggaggggaagacattgttcctattcctttattttcttctcac |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7562692 |
ctgaaggcgtcgaagaagagttatcagaatcaggaggggaagacattgttcctattcctttattttcttctcac |
7562619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University