View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_high_107 (Length: 235)
Name: NF15932_high_107
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_high_107 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 34 - 221
Target Start/End: Complemental strand, 6966062 - 6965877
Alignment:
| Q |
34 |
aaagaaaaaataatctgttctgtcctttccttaatcctactattgttccaaaatgtccaccgaattctatagcttttaggcaagtgattcggatggtgat |
133 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6966062 |
aaagaaaaaataatatgttctgtcctttccttaatcctactattgttccaaaatgtccaccgaattctagagcttttaggcaagtgattcggatggtgat |
6965963 |
T |
 |
| Q |
134 |
tgaattaacaatgttattaaatcctgactcaataaacacttaatatgagagtttatatataaattgtttctaccatagaagagaaaat |
221 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6965962 |
tgaattaacaatgttattaaatcctga--caataaacacttaatatgagagtttatatataaattgtttctaccatagaagagaaaat |
6965877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 6966166 - 6966135
Alignment:
| Q |
1 |
caaagtgtagtatattgtgattttgtcaaact |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6966166 |
caaagtgtagtatattgtgattttgtcaaact |
6966135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University