View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_high_110 (Length: 232)
Name: NF15932_high_110
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_high_110 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 215
Target Start/End: Original strand, 38872212 - 38872412
Alignment:
| Q |
15 |
ttctatataacacgtggactacatatgaacttcattatttattaatcataatgaattctggcatagagtgccccaagtcacataataaactacaattttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38872212 |
ttctatataacacgtggactacatatgaacttcattatttattaatcataatgaattctggcatagagtgccccaagtcacataataaactacaattttg |
38872311 |
T |
 |
| Q |
115 |
tatttctgatattatggatctatgctattttgtcgaacagttttgggcttttggctttggataagatatcttctaccggtttgttttgcaataccttctt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38872312 |
tatttctgatattatggatctatgctattttgtcgaacagttttgggcttttggctttggataagatatcttctaccggtttgttttgcaataccttctt |
38872411 |
T |
 |
| Q |
215 |
t |
215 |
Q |
| |
|
| |
|
|
| T |
38872412 |
t |
38872412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University