View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_high_111 (Length: 228)
Name: NF15932_high_111
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_high_111 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 11 - 209
Target Start/End: Original strand, 14392497 - 14392695
Alignment:
| Q |
11 |
tagataatacttaatagtatattgttgtaggaaggtatttgtcattgctctgaaaaagattcttccattgtgttgcagtaactttgtgaactagattagt |
110 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14392497 |
tagatattacttaatagtatattgttgtaggaaggtatttgtcattgctctgaaaaatattcttccattgtgttgcagtaactttgtgaactagattagt |
14392596 |
T |
 |
| Q |
111 |
tgacacttgtatcatatttatcatgaatatcaataattataatactatactttgtcgaagatttttcaattgaaaaatgatagtatctcagtcagttgg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14392597 |
tgacacttgtatcatatttatcatgaataataataattataatactatgctttgtcgaagatttttcaattgaaaaatgatagtatctcagtcagttgg |
14392695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University