View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_high_118 (Length: 208)
Name: NF15932_high_118
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_high_118 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 46847598 - 46847414
Alignment:
| Q |
17 |
actgtatataccttaattttaattactcttcgtaattactcttattttctgagtgtggttgtttgtgcttgtgcttcacccttgtcttacgagaaaccat |
116 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46847598 |
actgtatataccccaattttaattactcttcgtaattactcttattttctgagtgtggttgtttgtgcttgtgcttcacccttgtcatacgagaaaccat |
46847499 |
T |
 |
| Q |
117 |
ttttcacttttattttgtattgacaacatcgttgtactagttcatttgtctatgtcctcactcacctcccttgtctctgctcctc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
46847498 |
ttttcacttttattttgtattgacaacatcattgtactagttcatttgtctatctcctcactcacctcccttgtctcttctcctc |
46847414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University