View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_high_120 (Length: 207)
Name: NF15932_high_120
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_high_120 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 7503440 - 7503266
Alignment:
| Q |
15 |
ttattctgcttgctgtttggctggtgctgcgcacgatctttcgtttgataccagccctcctgatgaaaaactggaaaactcctccactttggctaacatg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7503440 |
ttattctgcttgctgtttggctggtgctgcacacgatctttcgtttgataccagccctcctgatgaaaaactggaaaactcctccactttggctaacatg |
7503341 |
T |
|
| Q |
115 |
taagtgattattgttcttttattttatgcttcaaatctttgttagataagataatttagatgtcaattccaatac |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7503340 |
taagtgattattgttcttttattttatgcttcaaatctttgttagataagataatttagatgtcaattccaatac |
7503266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University