View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_high_121 (Length: 206)
Name: NF15932_high_121
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_high_121 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 55 - 189
Target Start/End: Original strand, 35154469 - 35154600
Alignment:
| Q |
55 |
taaaaataaagctgacttatatgaatagaataacttattgagtcaccacgaaatatgaataaacttagaataatagcgtaagttaccgtcaccaaacaaa |
154 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35154469 |
taaaaataatgctgacttatatgaatagaataacttattgagtcaccacgaaatatgaataaacttagaataatagcgtaagttaccgtcaccaaacaaa |
35154568 |
T |
|
| Q |
155 |
tcgcaagttaataatcatactagtccatctatatt |
189 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||| |
|
|
| T |
35154569 |
tcgcaagt---taatcataccagtccatctatatt |
35154600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 6 - 54
Target Start/End: Original strand, 35154399 - 35154447
Alignment:
| Q |
6 |
gtgtgtctgatttaatctagtgtgccatgattctttttggagtacgatg |
54 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35154399 |
gtgtgtctaatttaatctaatgtgccatgattctttttggagtacgatg |
35154447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 5 - 54
Target Start/End: Complemental strand, 53975598 - 53975549
Alignment:
| Q |
5 |
tgtgtgtctgatttaatctagtgtgccatgattctttttggagtacgatg |
54 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
53975598 |
tgtgtgtctgatttaatctaatgtgccatgactctttttggagtacgatg |
53975549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University