View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_high_123 (Length: 202)
Name: NF15932_high_123
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_high_123 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 19 - 184
Target Start/End: Original strand, 46952487 - 46952648
Alignment:
| Q |
19 |
gcaaattgtatatcttagcaatgaaataaaattgtttaactgattatactttcataagaaattttcgtcgcgacaacaaacattcaataccaaagttttc |
118 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46952487 |
gcaaattttatatcttagcaatgaaataaaattgtttaactgattatactttcataagaaattttcgtcgcgacaacaaacattcaataccaaagttttc |
46952586 |
T |
|
| Q |
119 |
tatgctgtaatattatttattatatacaagaacactcatggtgattgagaatatacatgtcactat |
184 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46952587 |
tatgctataata----ttattatatacaagaacactcatggtgattgagaatatacatgtcactat |
46952648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University