View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_high_53 (Length: 336)
Name: NF15932_high_53
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_high_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 18 - 330
Target Start/End: Original strand, 15681519 - 15681831
Alignment:
| Q |
18 |
ggatgtacagaaacacatagaacaatcataaatcaaccgtcaaaaataacatttgatgctacaaaagttggaaattttcactttgtggctgagcttttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15681519 |
ggatgtacagaaacacatagaacaatcataaatcaaccgtcaaaaataacatttgatgctacaaaagttggaaattttcactttgtggctgagcttttga |
15681618 |
T |
 |
| Q |
118 |
ggtctgaacctgatttaataagggatgtggatgacaaaaaccgaagcatatttcacattgctgttcaacattgtcattcaagcatctttagtctaataca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15681619 |
ggtctgaacctgatttaataagggatgtggatgacaaaaacagaagcatatttcacattgctgttcaacattgtcattcaagcatctttagtctaataca |
15681718 |
T |
 |
| Q |
218 |
tgagttaggctctttcaaagattcaattatagatcttgaggatgatgaaagaaataacatattacattatgctgcaaaattagcacctccttctcagctt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15681719 |
tgagttaggctctttcaaagattcaattatagatcttgaggatgatgaaagaaataacatattacattatgctgcaaaattagcacctccttctcagctt |
15681818 |
T |
 |
| Q |
318 |
aacttcatttcag |
330 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
15681819 |
aacttaatttcag |
15681831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University