View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_high_62 (Length: 310)
Name: NF15932_high_62
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_high_62 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 8 - 310
Target Start/End: Original strand, 5251340 - 5251642
Alignment:
| Q |
8 |
agaagaaggacatgattctgagatggagaaactcactagagctcaacgaaagagaattcgtaagaagaagatgaaggaagaagcaatactacgtggaaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5251340 |
agaagaaggacatgattctgagatggagaaactcactagagctcaacgaaagagaattcgtaagaagaagatgaaggaagaagcaatactacgtggaaaa |
5251439 |
T |
|
| Q |
108 |
ttgattgggccattgttgcctccgacccaagcaacccagtgtggggatgatgctcctcctccaactgttcgatcaaatgcttctcaggaaggttattcaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5251440 |
ttgattgggccattgttgcctccgacccaagcaacccagtgtggggatgatgctcctcctccaactgttcgatcaaatgcttctcaggaaggttattcaa |
5251539 |
T |
|
| Q |
208 |
ttgcaaacctattgactatgtttcatcatttatgaatgtcttgcttatttccttaacaaaataagagtaaagaccaaatttagtatctcacaatttttgg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
5251540 |
ttgcaaacctattgactatgtttcatcatttatgaatgtcttgcttatttccttaacaaaataagagtaaaggccaaatttagtatctcacaattttcgg |
5251639 |
T |
|
| Q |
308 |
cca |
310 |
Q |
| |
|
||| |
|
|
| T |
5251640 |
cca |
5251642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University