View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_high_71 (Length: 292)
Name: NF15932_high_71
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_high_71 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 232
Target Start/End: Original strand, 9764370 - 9764584
Alignment:
| Q |
18 |
aggtcaaggttgtttgagtggtggtgagaagttgtgttccaggttagataacatcttatgatgcctcaagcatgagaacatcagaatctgtttggttcgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9764370 |
aggtcaaggttgtttgagtggtggtgagaagttgtgttccaggttaaataacatcttatgatgcctcaagcatgagaacatcagaatctgtttggttcgt |
9764469 |
T |
|
| Q |
118 |
ttctaatttggcaaagtgtaggggtatggctatgatgggtttgtcttttgatacttatgatgtatcaaacactatgtgagtggatgtaatggagggtggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9764470 |
ttctaatttggcaaagtgtaggggtatggctatgatgggtttgtcttttgatacttatgatgtatcaaacactgtgtgagtggatgtaatggagggtggt |
9764569 |
T |
|
| Q |
218 |
tcagattctattgtg |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9764570 |
tcagattctattgtg |
9764584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 30 - 184
Target Start/End: Complemental strand, 24493575 - 24493421
Alignment:
| Q |
30 |
tttgagtggtggtgagaagttgtgttccaggttagataacatcttatgatgcctcaagcatgagaacatcagaatctgtttggttcgtttctaatttggc |
129 |
Q |
| |
|
||||||||| ||| ||| |||| ||| |||||| ||||||||||| ||| ||||||||||||||||||||||| || |||||||| ||||| ||| || |
|
|
| T |
24493575 |
tttgagtggaggtaagaggttgagtttcaggttggataacatcttctgacgcctcaagcatgagaacatcagagtcagtttggttggtttcaggttttgc |
24493476 |
T |
|
| Q |
130 |
aaagtgtaggggtatggctatgatgggtttgtcttttgatacttatgatgtatca |
184 |
Q |
| |
|
||| |||| || ||||||||||| |||||||||| ||||||| ||||||||||| |
|
|
| T |
24493475 |
aaattgtaaggtcatggctatgattggtttgtcttctgatactgatgatgtatca |
24493421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University