View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_high_82 (Length: 276)
Name: NF15932_high_82
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_high_82 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 5952343 - 5952600
Alignment:
| Q |
1 |
ttttccaagaatacctccaacctgtcaacatgtcagtgtcatattcggtgtttgcctcggtgcttcatggctcacgagcgcctcacaaaaatgttaaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5952343 |
ttttccaagaatacctccaacctgtccacatgtcagtgtcatattcggtgtttgcctcggtgcttcatagctcacgagcgcctcacaaaaatgttaaaaa |
5952442 |
T |
|
| Q |
101 |
ttgtatcccattatgattcaaaatctatgtagcaccgacacttcttctgatttaaaggtgtgtccattgtttgacatgtgtaggtgccagacactgacac |
200 |
Q |
| |
|
||||||| |||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5952443 |
ttgtatctcattctgactcaaaatctatgtagcaccgaca---cttctgatttaaaggtgtgtccattgtttgacatgtgtaggtgccagacactgacac |
5952539 |
T |
|
| Q |
201 |
gacaccaacacacatgtgtacattcaaatcattcatttactaaaattatcatcaataatct |
261 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5952540 |
gacaccgacacacatgtgtacattcaaatcattcatttactaaaattatcatcaataatct |
5952600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University