View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15932_high_84 (Length: 269)

Name: NF15932_high_84
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15932_high_84
NF15932_high_84
[»] chr8 (1 HSPs)
chr8 (53-160)||(40651920-40652027)


Alignment Details
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 53 - 160
Target Start/End: Complemental strand, 40652027 - 40651920
Alignment:
53 gagggaagattgcattgtgaggatggttggaagaaaaaaggcgggacgaaaggagaggagaacttgaagccgattttaatggctacaatcgcactgctgc 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40652027 gagggaagattgcattgtgaggatggttggaagaaaaaaggcgggacgaaaggagaggagaacttgaagccgattttaatggctacaatcgcactgctgc 40651928  T
153 acgtcacc 160  Q
    ||||||||    
40651927 acgtcacc 40651920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University