View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_high_86 (Length: 256)
Name: NF15932_high_86
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_high_86 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 18 - 176
Target Start/End: Complemental strand, 13713009 - 13712852
Alignment:
| Q |
18 |
cctttggcacctaccatcttctgctgcaaaacccttgtgaatctgacattgtcgcatattcgtgttgccactatgtttcattgttctattaatcttcctt |
117 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13713009 |
cctttggcgcctacaatcttctgctgcaaaacccttgtgaacctgacattgacgcttattcgtgttgccactatgtttcattgttctattaatcttcctt |
13712910 |
T |
|
| Q |
118 |
tgctcaaaaccctttatctatcttcagttcaatctgaagatatgattagatttcatgaa |
176 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
13712909 |
tgctcaaaacccgttatctatcttcagttcaatttgaagatatga-aagatttcatgaa |
13712852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 185 - 251
Target Start/End: Complemental strand, 13712665 - 13712599
Alignment:
| Q |
185 |
taatcatgcatcctcctttgtcagcatcggtaatatattattacattgtatcatctttcttctcact |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13712665 |
taatcatgcatcctcctttgtcagcatcggtaatatattattacattgtatcatctttctactcact |
13712599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University