View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_high_96 (Length: 248)
Name: NF15932_high_96
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_high_96 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 53 - 232
Target Start/End: Complemental strand, 40185690 - 40185520
Alignment:
| Q |
53 |
gagggaggtgttagtattattgggctactaaaaattgttaacataacagcccaagttagcccaacccaagagcaagaaaaatgacaaaaatgtggctaaa |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
40185690 |
gagggaggtgttagtattattgggctactaaaaattgttaacataacagcccaagttagcccaaaccaagagcaagaaaaatgacaaaaatgtgggtaaa |
40185591 |
T |
 |
| Q |
153 |
tgtctcagaagatactagaaagaaatatctacagcaaacgtcagggcacacgaaaacacaacattattttgataagaaat |
232 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40185590 |
t---------gatactagaaagaaatatctgcagcaaacgtcagggcacacgaaaacacaacattattttgataagaaat |
40185520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University