View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_low_101 (Length: 244)
Name: NF15932_low_101
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_low_101 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 9786069 - 9786291
Alignment:
| Q |
17 |
atttataataaatttaatttgattttgtgtggtgggtaacctgattctacaaaactttgctataataataatatccacgcatcatgccaaattgaaaagt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
9786069 |
atttataataaatttaatttgattttgtgtggtgggtaacctgattctacaaaactttgctataata------tccacaaatcgtgccaaattgaaaagt |
9786162 |
T |
 |
| Q |
117 |
ttgcaagtaatatat-gaaaaacaggaaagtacttgttttaatcgtgtgatatttgcttaccatccattgcaaattgcaaccgtacaacaaggctaaaac |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9786163 |
ttgcaagtaatatatagaaaaacaggaaagtacttgttttaatcgtgtgatatttgcttaccatccattgcaaattgcaaccgtacaacaaggctaaaac |
9786262 |
T |
 |
| Q |
216 |
aaaaagacaacgacttcatgtcgctttct |
244 |
Q |
| |
|
||||||||||||||||||||||| ||||| |
|
|
| T |
9786263 |
aaaaagacaacgacttcatgtcgttttct |
9786291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University