View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15932_low_105 (Length: 238)

Name: NF15932_low_105
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15932_low_105
NF15932_low_105
[»] chr8 (1 HSPs)
chr8 (18-238)||(40652139-40652358)


Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 40652358 - 40652139
Alignment:
18 gaaatggtctaggaggaggggaaaacccagttgtcttattccttgagcgagtagggctagttgagaacgaaccactctttcgagacattttgcgttaact 117  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40652358 gaaatggtctaggaggaggtgaaaacccagttgtcttattccttgagcgagtagggctagttgagaacgaaccactctttcgagacattttgcgttaact 40652259  T
118 ttgttattgagtactatagctgaatacaaatcaaatgttagagtaatgaaaacatgcatgattgaaacaaattcaaaagattatatgaaaactcaccaaa 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
40652258 ttgttattgagtactatagctgaatacaaatcaaatgttagagtaatgaaaacatgcatgattgaaacaaattcaaaagattatatg-aaactcaccaaa 40652160  T
218 aggggaaataataaaaatgat 238  Q
    |||||||||||||||||||||    
40652159 aggggaaataataaaaatgat 40652139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University