View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_low_106 (Length: 238)
Name: NF15932_low_106
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_low_106 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 6264645 - 6264521
Alignment:
| Q |
1 |
ttttttattcactcatattatc---ttagtatctaaggtttgaacctctatctcaaactccttggatatcttagctcaatcacttgagctacatcataga |
97 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6264645 |
ttttttattcactcatattatcatcttagcatctaaggttcgaacctctttctcaagctccttggatatcttagctcaatcacttgagctacatcataga |
6264546 |
T |
 |
| Q |
98 |
gtaattaaatttaaatttgggttta |
122 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
6264545 |
gtaattaagtttaaatttgggttta |
6264521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 120 - 221
Target Start/End: Complemental strand, 6264444 - 6264344
Alignment:
| Q |
120 |
ttaaaattcaaactccgggccttttaactctaactcctttaaccattaactcaaccaactaagttatccatccgtcctccacacattaacaaacattggt |
219 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6264444 |
ttaaaattcaaactccaa-ccttttaactctaactcctttaaccattaactcaaccaactaagttatccatccgtcctccacacattaacaaacattggt |
6264346 |
T |
 |
| Q |
220 |
cc |
221 |
Q |
| |
|
|| |
|
|
| T |
6264345 |
cc |
6264344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University