View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_low_107 (Length: 237)
Name: NF15932_low_107
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_low_107 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 5251668 - 5251890
Alignment:
| Q |
1 |
aaccaatttaatcctgacaataagtaatagtcaaattcatctctaacatttttatattagagataaattagtttctctgttataatgagtcggagactgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5251668 |
aaccaatttaatcctgacaataagtaatagtcaaattcatctctaacatttttatattagagataaattagtttctctgttataatgagtctgagactgt |
5251767 |
T |
|
| Q |
101 |
ggtataaaaatgctagcgactagtttagtattatttttgtcggtaggattaaattgggttgcaataaaactgtgaagatcttctctcaaaaacgaatgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5251768 |
ggtataaaaatgctagcgactagtttagtattatttttgtcggtaggattaaattgggttgcaataaaactgtgaagatcttctctcaaaaacgaatgtc |
5251867 |
T |
|
| Q |
201 |
ttgattatgttgatgtgaaagtg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5251868 |
ttgattatgttgatgtgaaagtg |
5251890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 90
Target Start/End: Original strand, 24849735 - 24849777
Alignment:
| Q |
48 |
atttttatattagagataaattagtttctctgttataatgagt |
90 |
Q |
| |
|
||||||||||||||||||||||| | ||| ||||||||||||| |
|
|
| T |
24849735 |
atttttatattagagataaattaatctctatgttataatgagt |
24849777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University