View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_low_116 (Length: 227)
Name: NF15932_low_116
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_low_116 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 44706988 - 44706789
Alignment:
| Q |
1 |
ccatcacgccatttgaaaattatcagctgccccctgaagctcaaccatttagtcctgtaagcacctaagttagtttttatttgttcattgtgcctataat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44706988 |
ccatcacgccatttgaaaattatcagctgccccctgaagctcaaccatttagtcctgtaagcacctaagttagtttttatttgttcattgtgcctataat |
44706889 |
T |
 |
| Q |
101 |
aaataccagtatcgaattatcttagcagtaaaagactcatttatttagcagattttgaaacattgcttcacaattgcagataaatttctaagatgtatca |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44706888 |
a----ccagtatcgaattatcttagcagtaaaagactcatttatttagcagattttgaaacattgcttcacaattgcagataaatttctaagatgtatca |
44706793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University