View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15932_low_122 (Length: 212)

Name: NF15932_low_122
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15932_low_122
NF15932_low_122
[»] chr6 (1 HSPs)
chr6 (24-197)||(2384935-2385108)


Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 24 - 197
Target Start/End: Original strand, 2384935 - 2385108
Alignment:
24 gagagaaccattccgattcccatcctttgcatcacgttgatacctttttcttgtcgtgttatcagttgagcaaacggtatgaaaattctgtcgtataacg 123  Q
    ||||| ||||||||||||||||| ||||||||||| || ||||||||||| |||||||||||||| || || ||||||||||||||||||| ||||||||    
2384935 gagagtaccattccgattcccattctttgcatcacatttatacctttttcctgtcgtgttatcagctgcgcgaacggtatgaaaattctgttgtataacg 2385034  T
124 gcatcaatagtataatggacaaggttatagcactttggagtgtggcgggtggtatcttgaaatttgaacctatg 197  Q
    ||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
2385035 gcatcaatagtattatagacaatgttatagcactttggagtgtggcgggtggtatcttgaaatttgaacctatg 2385108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University