View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_low_122 (Length: 212)
Name: NF15932_low_122
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_low_122 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 24 - 197
Target Start/End: Original strand, 2384935 - 2385108
Alignment:
| Q |
24 |
gagagaaccattccgattcccatcctttgcatcacgttgatacctttttcttgtcgtgttatcagttgagcaaacggtatgaaaattctgtcgtataacg |
123 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||| || ||||||||||| |||||||||||||| || || ||||||||||||||||||| |||||||| |
|
|
| T |
2384935 |
gagagtaccattccgattcccattctttgcatcacatttatacctttttcctgtcgtgttatcagctgcgcgaacggtatgaaaattctgttgtataacg |
2385034 |
T |
 |
| Q |
124 |
gcatcaatagtataatggacaaggttatagcactttggagtgtggcgggtggtatcttgaaatttgaacctatg |
197 |
Q |
| |
|
||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2385035 |
gcatcaatagtattatagacaatgttatagcactttggagtgtggcgggtggtatcttgaaatttgaacctatg |
2385108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University