View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_low_53 (Length: 344)
Name: NF15932_low_53
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_low_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 3 - 331
Target Start/End: Original strand, 48674754 - 48675079
Alignment:
| Q |
3 |
acaagaacttatgattatatatagaagaagaagaaggtagtgatgaattatgattagtgaaaaatgtgtcagaacacgtaggaaccgacaagggtggccc |
102 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48674754 |
acaagaacttatgattatatatagaa---gaagaaggtagtgatgaattatgattagtgaaaaatgtgtcagaacacgtaggaaccgacaagggtggccc |
48674850 |
T |
|
| Q |
103 |
ctaacctaatagatatgaaaacgacaaagcagtcttcgtcacattgtctctctcccaaatagactttgcttcaacagctcatccttgtaggattgcccaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48674851 |
ctaacctaatagatatgaaaacgacaaagcagtcttcgtcacattgtctctctcccaaatagactttgcttcaacagctcatccttgtaggattgcccaa |
48674950 |
T |
|
| Q |
203 |
ccctgtctgtctctactctctacaatctaatactcaatactatactatatatgaatttctgcctcattttcaggcttccattttgttatttccatgttga |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48674951 |
ccctgtctgtctctactctctacaatctaatactcaatactatactatatacgaatttctgcctcattttcaggcttccattttgttatttccatgttga |
48675050 |
T |
|
| Q |
303 |
tatatcaagtatcatatcaacaaacacct |
331 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48675051 |
tatatcaagtatcatatcaacaaacacct |
48675079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University