View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_low_69 (Length: 298)
Name: NF15932_low_69
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_low_69 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 19 - 286
Target Start/End: Original strand, 3420711 - 3420978
Alignment:
| Q |
19 |
ctattctgccacgtggacgatccagatcgcattcgcaccacatcaataaactcgtggttcccagcggtgagtccaccggaggaatcccaccgcgtcttgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3420711 |
ctattctgccacgtggacgatccagatcgcattcgcaccacatcaataaactcgtggttcccagcggtgagtccaccggaggaatcccaccgcgtcttgc |
3420810 |
T |
|
| Q |
119 |
aaatcgccgcattgtgtcctttctcacgcaaaaatgacatcacgttacggttataaaccgaaatgctttgtttcttcagaaaatcgaatttcaccgcagc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3420811 |
aaatcgccgcattgtgtcctttctcacgcaaaaatgacatcacgttacggttataaaccgaaacgctttgtttcttcagaaaatcgaatttcaccgcagc |
3420910 |
T |
|
| Q |
219 |
ttcagaaacatgcaatcgaagcatgttcaggtaagaatctgcattagcattttcagcacttcatctca |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3420911 |
ttcagaaacatgcaatcgaagcatgttcaggtaagaatctgcattagcattttcagcacttaatctca |
3420978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University