View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_low_82 (Length: 282)
Name: NF15932_low_82
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_low_82 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 18 - 269
Target Start/End: Original strand, 53452017 - 53452274
Alignment:
| Q |
18 |
aacccattagcgtggcggtaaatgtattgatcgtgagcaggcttggtaaaatctggaaggnnnnnnnn--gaggatgaaaatagaggt--aaggttaatg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |||| ||| |
|
|
| T |
53452017 |
aacccattagcgtggcggtaaatgtattgatcgtgagcaggcttggtaaaatctggaaggaaaaaaaaatgaggatgaaaatagaggtttagggtttatg |
53452116 |
T |
 |
| Q |
114 |
tggnnnnnnn--tgaataaagagtgaattgagttacctagagcgaaataagtgacgaaattggtttcaacggcagaaggaggaatgaggggaagattctc |
211 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
53452117 |
tggaaaaaaaaatgaataaagagtgaattgagttacctagagcgaaataagtgacgaaattggtttcaatggcagaaggaggaatgaggggaaaattctc |
53452216 |
T |
 |
| Q |
212 |
aacatcagggagtagaagcttctctaaatcatcttcttctgaactattcgattcgtct |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53452217 |
aacatcagggagtagaagcttctctaaatcatcttcttctgaactattcgattcgtct |
53452274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 124 - 251
Target Start/End: Complemental strand, 31053708 - 31053581
Alignment:
| Q |
124 |
tgaataaagagtgaattgagttacctagagcgaaataagtgacgaaattggtttcaacggcagaaggaggaatgaggggaagattctcaacatcagggag |
223 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31053708 |
tgaataatgagtgaattgagttacctagagcgaaataagtgacgaaattggtttcaacggcagaaggaggaatgaggggaagattctgaacatcagggag |
31053609 |
T |
 |
| Q |
224 |
tagaagcttctctaaatcatcttcttct |
251 |
Q |
| |
|
|||||||||||||||||| || |||||| |
|
|
| T |
31053608 |
tagaagcttctctaaatcgtcctcttct |
31053581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 75
Target Start/End: Complemental strand, 31053817 - 31053763
Alignment:
| Q |
21 |
ccattagcgtggcggtaaatgtattgatcgtgagcaggcttggtaaaatctggaa |
75 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||| || || ||||||||||||| |
|
|
| T |
31053817 |
ccattagtgtggcggtaaatgtattgatcatgagctggtttagtaaaatctggaa |
31053763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University