View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_low_85 (Length: 273)
Name: NF15932_low_85
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_low_85 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 254
Target Start/End: Original strand, 24321713 - 24321949
Alignment:
| Q |
18 |
gaagacagcagttgtatgtgttgtgtggtttggattcaaatttcaattcatcaaatcacaatacataacgtgagttacaagattaggtttttattcaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24321713 |
gaagacagcagttgtatgtgttgtgtggtttggattcaaatttcaattcatcaaatcacaatacataacgtgagttacaagattaggtttttattcaaat |
24321812 |
T |
 |
| Q |
118 |
ctcttcccaattcctttattcaccgtgnnnnnnncttgtatctctttataaataaaccctaccaactaaatcaatctgaaccctaatcaaagcatcactg |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24321813 |
ctcttcccaattcctttattcaccgtgtttttttcttgtatctctttataaataaaccctaccaactaaatcaatctgaaccctaatcaaagcatcactg |
24321912 |
T |
 |
| Q |
218 |
gtagtagtgacagaagacgcgtgaatggaggcggatc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24321913 |
gtagtagtgacagaagacgcgtgaatggaggcggatc |
24321949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 34 - 107
Target Start/End: Original strand, 24333834 - 24333907
Alignment:
| Q |
34 |
tgtgttgtgtggtttggattcaaatttcaattcatcaaatcacaatacataacgtgagttacaagattaggttt |
107 |
Q |
| |
|
||||| |||||||||||||| ||| | |||| | |||||||||||||| ||||| |||||| ||||||||||| |
|
|
| T |
24333834 |
tgtgtcgtgtggtttggattgaaactcgaatttaacaaatcacaatacagaacgtaagttacgagattaggttt |
24333907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University