View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_low_91 (Length: 254)
Name: NF15932_low_91
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_low_91 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 3 - 235
Target Start/End: Original strand, 35764345 - 35764577
Alignment:
| Q |
3 |
ttctttctatgctgaattattggctgctattctagctttagagattgctcaaagaaaggggttcaactatctctggcttgaaaaagactctcaactagtt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35764345 |
ttctttctatgctgaattattggctgctattctagctttagaaattgctcaaagaaaggggttcaactatctctggcttgaaacagactctcaactagtt |
35764444 |
T |
|
| Q |
103 |
ttcttgacccttaagacttctgcaaatgttcccttgaatataagaaatagatggcataactctttatcttttgctagaaacattcattttactttttctc |
202 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35764445 |
ttcttggcccttaagacttctgcaaatgttcccttgaatataagaaatagatggcataactgtttatcttttgctagaaacattcattttactttttctc |
35764544 |
T |
|
| Q |
203 |
atgtgtatagggagggaaatgtttgtgccgatg |
235 |
Q |
| |
|
||||||| |||||||||||||||||||| |||| |
|
|
| T |
35764545 |
atgtgtacagggagggaaatgtttgtgctgatg |
35764577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 143 - 235
Target Start/End: Complemental strand, 17962615 - 17962523
Alignment:
| Q |
143 |
taagaaatagatggcataactctttatcttttgctagaaacattcattttactttttctcatgtgtatagggagggaaatgtttgtgccgatg |
235 |
Q |
| |
|
||||||| |||||||| |||| |||| |||||| ||| |||| ||||||||||||||||||| |||||||| || |||| |||||| |||| |
|
|
| T |
17962615 |
taagaaacagatggcacaactgtttagcttttgttaggggcattaattttactttttctcatgtatatagggaaggtaatgcttgtgctgatg |
17962523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 43 - 193
Target Start/End: Original strand, 13596910 - 13597060
Alignment:
| Q |
43 |
gagattgctcaaagaaaggggttcaactatctctggcttgaaaaagactctcaactagttttcttgacccttaagacttctgcaaatgttcccttgaata |
142 |
Q |
| |
|
||||||||||||||| | | | ||| ||||| ||||| |||| || ||| |||||||||| ||||| || ||| |||||||||||||||| | ||| |
|
|
| T |
13596910 |
gagattgctcaaagagaagtatacaattatctttggctggaaactgattctgaactagtttttttgacactcaagtcttctgcaaatgttccttggaacc |
13597009 |
T |
|
| Q |
143 |
taagaaatagatggcataactctttatcttttgctagaaacattcatttta |
193 |
Q |
| |
|
|||||| ||||||||||||| |||| |||||| || ||||||||| |||| |
|
|
| T |
13597010 |
taagaacaagatggcataactgtttagcttttgttaaaaacattcacttta |
13597060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 143 - 235
Target Start/End: Complemental strand, 815304 - 815212
Alignment:
| Q |
143 |
taagaaatagatggcataactctttatcttttgctagaaacattcattttactttttctcatgtgtatagggagggaaatgtttgtgccgatg |
235 |
Q |
| |
|
||||||| |||||||| |||| |||| |||||| ||| |||| ||||||||||||||||||| |||||||| || |||| |||||| |||| |
|
|
| T |
815304 |
taagaaacagatggcacaactgtttagcttttgttaggggcattaattttactttttctcatgtatatagggaaggtaatgcttgtgctgatg |
815212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 143 - 235
Target Start/End: Complemental strand, 28688153 - 28688061
Alignment:
| Q |
143 |
taagaaatagatggcataactctttatcttttgctagaaacattcattttactttttctcatgtgtatagggagggaaatgtttgtgccgatg |
235 |
Q |
| |
|
||||||| |||||||| |||| |||| |||||| ||| |||| ||||||||||||||||||| |||||||| || |||| |||||| |||| |
|
|
| T |
28688153 |
taagaaacagatggcacaactgtttagcttttgttaggggcattaattttactttttctcatgtatatagggaaggtaatgcttgtgctgatg |
28688061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University