View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_low_93 (Length: 253)
Name: NF15932_low_93
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_low_93 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 113 - 238
Target Start/End: Original strand, 32416420 - 32416545
Alignment:
| Q |
113 |
caactgtgcctcttccacttatagagaaattgataacttggaaccattcacaaatgctcttgaaactaattgcacagttaaatgtggactcctatgcaca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32416420 |
caactgtgcctcttccacttatagagaaattgataatttggaaccattcacaaatgctcttgaaactaattgcacagttaaatgtggactcctatgcaca |
32416519 |
T |
|
| Q |
213 |
aaagcttcaaatttaggagaagtaac |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32416520 |
aaagcttcaaatttaggagaagtaac |
32416545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 32416312 - 32416389
Alignment:
| Q |
1 |
taaacgaatagctttggtgagaacaatgaatgaattatattattctgcttcacaaaatatcatttcaatagatacata |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32416312 |
taaacgaatagctttggtgagaacaatgaatgaattatattattctgcttcacaaaatatcatttcaatagatacata |
32416389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University