View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15932_low_98 (Length: 248)
Name: NF15932_low_98
Description: NF15932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15932_low_98 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 9 - 229
Target Start/End: Original strand, 41753598 - 41753812
Alignment:
| Q |
9 |
aattattcttaaattaccttttgttatagagatatatcttcagaagaaaccttttatatttaaggacaagttttttctttaaaaggtagtattacataat |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
41753598 |
aattattattaaattaccttttgttatagagatatatcttcagaagaaaccttttatatttaaggacaagttttttctttaaaaggtatt-----ataat |
41753692 |
T |
|
| Q |
109 |
ttgttttcttttactggtaaacggatggagtaatattctcattttcaaggtaatttttgctttatgaaatgaaaagatttgaacgtacaccaattgctgt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41753693 |
ttgttttcttttactggtaaacggatggagtaatattttcattttcaaggtaa-ttttgctttatgaaatgaaaagatttgaacgtacaccaattgctgt |
41753791 |
T |
|
| Q |
209 |
atcaagctggatgttcccgtg |
229 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41753792 |
atcaagctggatgttcccgtg |
41753812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University