View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15933_low_11 (Length: 218)
Name: NF15933_low_11
Description: NF15933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15933_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 8 - 200
Target Start/End: Complemental strand, 7645943 - 7645754
Alignment:
| Q |
8 |
gtccaagaaaatcacccaggttataattagttaatttgcttatgatcatacatggacaactagnnnnnnnccttacgtttaaaacattttacaccgtcaa |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7645943 |
gtccatgaaaatcacccaggttataattagttaatttgcttatgatcatacatggacaactagtttttttccttacgtttaaaacattttacaccgtcat |
7645844 |
T |
 |
| Q |
108 |
tttcttattacttttgtagaggtcatgatggaaattaattattaagcctaattcagacttgtttgtttttgtgcatgaagattatgacaagac |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7645843 |
tttcttattacttttgtagaggtcatg---gaaattaattattaagcctaattaagacttgtttgtttttgtgcatgaagattatgacaagac |
7645754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University