View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15934_high_10 (Length: 325)
Name: NF15934_high_10
Description: NF15934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15934_high_10 |
 |  |
|
| [»] scaffold0077 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 33 - 296
Target Start/End: Complemental strand, 46221382 - 46221119
Alignment:
| Q |
33 |
aggaaggttggggaaacggcggcgtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46221382 |
aggaaggttggggaaacggcggcgtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaa |
46221283 |
T |
 |
| Q |
133 |
cgggaaacagacgcgtgaagttccgatcaggtctccacgcgctagtcctttgcctggatatctcacgcgcggttgaattcaatcgctaaattctaggttt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46221282 |
cgggaaacagacgcgtgaagttccgatcaggtctccacgcgctagtcctttgcctggatatctcacgcgcggttgaattcaatcgctaaattctaggttt |
46221183 |
T |
 |
| Q |
233 |
gctagggagttgatgaaattactagattgatatgcacgtgatctgtgatcgatcgcacgtgtat |
296 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46221182 |
gttagggagttgatgaaattactagattgatatgcacgtgatctgtgatcgatcgcacgtgtat |
46221119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 46 - 183
Target Start/End: Original strand, 29830997 - 29831134
Alignment:
| Q |
46 |
aaacggcggcgtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaacgggaaacagacg |
145 |
Q |
| |
|
||||| ||| ||||||||||||||||| |||||||||||||| |||||||||||||||||||| || || ||| | || ||||||||||| | ||| || |
|
|
| T |
29830997 |
aaacgacggtgtttggcagaaggagatattgatgggaggaaaatgtgagccgttggatttctcaggcgttattcattatgatattaacggaagacaaacc |
29831096 |
T |
 |
| Q |
146 |
cgtgaagttccgatcaggtctccacgcgctagtccttt |
183 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||| |
|
|
| T |
29831097 |
ggtgaagttcctctcaggtctccacgcgctattccttt |
29831134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0077 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0077
Description:
Target: scaffold0077; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 56 - 142
Target Start/End: Complemental strand, 10521 - 10435
Alignment:
| Q |
56 |
gtttggcagaaggagattttgatgggaggaaagtgtgagccgttggatttctccggtgtgatttactacgatattaacgggaaacag |
142 |
Q |
| |
|
||||||||||| ||| |||||||| | |||||||| |||||||||||||| ||||||||||| || || | ||| ||||||||| |
|
|
| T |
10521 |
gtttggcagaaaacgatcttgatgggtgataagtgtgaaccgttggatttctctggtgtgatttattatgacaataaggggaaacag |
10435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University