View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15934_high_11 (Length: 321)
Name: NF15934_high_11
Description: NF15934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15934_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 192 - 303
Target Start/End: Original strand, 54402743 - 54402854
Alignment:
| Q |
192 |
aagtatgtaaccctaatgacttatttatctactatcaatttatcataaaagcaaaaaatgttgtaactttaattaaatttaatgtcttttatcctcattg |
291 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54402743 |
aagtatgtaaccctaattacttatttatctactattaatttatcataaaagcataaaatgttgtaactttaattaaatttaatgtcttttatcctcattg |
54402842 |
T |
|
| Q |
292 |
atcgacaatgtt |
303 |
Q |
| |
|
|||||||||||| |
|
|
| T |
54402843 |
atcgacaatgtt |
54402854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 15 - 86
Target Start/End: Original strand, 54402611 - 54402685
Alignment:
| Q |
15 |
agcataggatccatagggaagccaatcactagttgaaaagagatgtagaatttaat---accattaatgatataa |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
54402611 |
agcataggatccatagggaagccaatcactagttgaaaagagatgtagaatttaatgcaaccattaatgatataa |
54402685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 23 - 72
Target Start/End: Original strand, 54402510 - 54402559
Alignment:
| Q |
23 |
atccatagggaagccaatcactagttgaaaagagatgtagaatttaatac |
72 |
Q |
| |
|
|||||||||||||| ||| |||||||| |||||||||||||||||||||| |
|
|
| T |
54402510 |
atccatagggaagcaaattactagttggaaagagatgtagaatttaatac |
54402559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University