View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15934_low_11 (Length: 384)
Name: NF15934_low_11
Description: NF15934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15934_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 4e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 183 - 366
Target Start/End: Complemental strand, 663956 - 663773
Alignment:
| Q |
183 |
tagcatgacatatccttattcaacccatacaatttcttaaatctttcactggtgaagaaaatcagccacaactttgatgagttttttgcccttatcagat |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
663956 |
tagcatgacatatccttattcaacccatacaatttcttaaatctttcactggtgaagaaaatcagccacaactttgatgagttttttgcccttatcagat |
663857 |
T |
 |
| Q |
283 |
tcaggatggaccatataataacaatgatcttcatcttcttcttcaaaaaattcaacttccccattccaatgactccctttcaca |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
663856 |
tcaggatggaccatataataacaatgatcttcatcttcttcttcaaaaaattcaacttccccattccaatgactccttttcaca |
663773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 18 - 94
Target Start/End: Complemental strand, 664131 - 664055
Alignment:
| Q |
18 |
agacacgcaagacaaaaacgacatagtagaaggacacgtaagacataaacaacatagtaaaaggtgctatatgtgtg |
94 |
Q |
| |
|
|||||||||||| ||||||||||||||| || |||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
664131 |
agacacgcaagataaaaacgacatagtaaaatgacacgtaagacgtagacaacatgataaaaggtgctatatgtgtg |
664055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 277 - 335
Target Start/End: Complemental strand, 47301960 - 47301902
Alignment:
| Q |
277 |
tcagattcaggatggaccatataataacaatgatcttcatcttcttcttcaaaaaattc |
335 |
Q |
| |
|
|||||||||||||| | |||| |||| |||||||||||||||||||||||| ||||| |
|
|
| T |
47301960 |
tcagattcaggatgaaagatatgataaacatgatcttcatcttcttcttcaaacaattc |
47301902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University