View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15934_low_19 (Length: 271)
Name: NF15934_low_19
Description: NF15934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15934_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 25 - 264
Target Start/End: Complemental strand, 31261433 - 31261194
Alignment:
| Q |
25 |
acacatccacaagttcgatgatcctacatgattgtaatttaatgatgatttgtgaatcaaaacgaattcagctcaatcaaactcaacatatttcacctca |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
31261433 |
acacatccacaagttcgatgatcctacatgattgtaatttaatgatgatttgtgaatcacaacgaattcagctcaatcgaactcaacatatttcacttca |
31261334 |
T |
|
| Q |
125 |
aaatcttaaatttagcatatacaaaaacgaaatgtatgatgaattatgaaaatacactttccttaattttaaactcttcacatcttcgatcacaaattca |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31261333 |
aaatcttaaatttagcatatacaaaaacgaaatgtatgatgaattatgaaaatacactttccttaattttaaactctttacatcttcgatcacaaattca |
31261234 |
T |
|
| Q |
225 |
tttgagcatggtttgatctgcttttaactaccctttgctt |
264 |
Q |
| |
|
||||||||||||| ||||||| ||||||||| |||||||| |
|
|
| T |
31261233 |
tttgagcatggttcgatctgcctttaactactctttgctt |
31261194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University