View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15934_low_19 (Length: 271)

Name: NF15934_low_19
Description: NF15934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15934_low_19
NF15934_low_19
[»] chr7 (1 HSPs)
chr7 (25-264)||(31261194-31261433)


Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 25 - 264
Target Start/End: Complemental strand, 31261433 - 31261194
Alignment:
25 acacatccacaagttcgatgatcctacatgattgtaatttaatgatgatttgtgaatcaaaacgaattcagctcaatcaaactcaacatatttcacctca 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |||    
31261433 acacatccacaagttcgatgatcctacatgattgtaatttaatgatgatttgtgaatcacaacgaattcagctcaatcgaactcaacatatttcacttca 31261334  T
125 aaatcttaaatttagcatatacaaaaacgaaatgtatgatgaattatgaaaatacactttccttaattttaaactcttcacatcttcgatcacaaattca 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
31261333 aaatcttaaatttagcatatacaaaaacgaaatgtatgatgaattatgaaaatacactttccttaattttaaactctttacatcttcgatcacaaattca 31261234  T
225 tttgagcatggtttgatctgcttttaactaccctttgctt 264  Q
    ||||||||||||| ||||||| ||||||||| ||||||||    
31261233 tttgagcatggttcgatctgcctttaactactctttgctt 31261194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University