View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15935_low_8 (Length: 228)
Name: NF15935_low_8
Description: NF15935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15935_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 10688721 - 10688928
Alignment:
| Q |
15 |
atgcataggtacggatacaataccaagtgtgacaaatacaacggtttacagaaattaaggtaagtcaataaaaaa-caagattctatcataaaaag-aaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |||||||||| ||| |
|
|
| T |
10688721 |
atgcataggtacggatacaataccaagtgtaacaaatacaacggtttaaagaaattaaggtaagtcaataaaaaaacaagattctttcataaaaaggaaa |
10688820 |
T |
|
| Q |
113 |
ctcaaatatgcaaataatattggtatcgaacaagtttcacgcatattggtattggaggctagctcttacatttttgtagaaaaaacatcacctgtttttc |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10688821 |
ctcaaatatgcaaataatattgatatcgaacaagtttcacgcatattggtataggagactagctcttacatttttgaagaaaaaacatcacctgtttttc |
10688920 |
T |
|
| Q |
213 |
atattctt |
220 |
Q |
| |
|
|| ||||| |
|
|
| T |
10688921 |
attttctt |
10688928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University