View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15936_low_4 (Length: 280)
Name: NF15936_low_4
Description: NF15936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15936_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 266
Target Start/End: Complemental strand, 31297430 - 31297181
Alignment:
| Q |
17 |
gttctaatgttgttcaccatgatcttcagcattcttttcaacagcaacatcaatcctttcataccttacatcagaaggatgttcaggtaatttagcaaga |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31297430 |
gttctaatgttgttcatcatgatcttcagcattcttttcaacagcaacatcaatcctttcataccttacatcagaaggatgttcaggtaatttagcaaga |
31297331 |
T |
|
| Q |
117 |
gactcttcgtcatgcttatgaaagaaaatcacccacataaacaaaaccacaaatgtcaccaatacaacacaaactgtcccaaaaatcacaccggctagaa |
216 |
Q |
| |
|
|||||||| ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31297330 |
gactcttcttcatgcttatggaaaaatatcacccacataaacaaaaccacaaatgtcaccaatacaacacaaactgtcccaaaaatcacaccggctagaa |
31297231 |
T |
|
| Q |
217 |
acgtcaaaggacgatactttcttctattcgcggcatcaagcttcgattgt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31297230 |
acgtcaaaggacgatactttcttctattcgcggcatcaagcttcgattgt |
31297181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University