View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15937_high_17 (Length: 308)
Name: NF15937_high_17
Description: NF15937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15937_high_17 |
 |  |
|
| [»] chr1 (41 HSPs) |
 |  |
|
| [»] scaffold0350 (1 HSPs) |
 |  |
|
| [»] chr7 (44 HSPs) |
 |  |
|
| [»] chr5 (44 HSPs) |
 |  |
|
| [»] chr3 (45 HSPs) |
 |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0012 (1 HSPs) |
 |  |  |
|
| [»] scaffold1127 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
| [»] scaffold0524 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 41)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 308
Target Start/End: Complemental strand, 1794919 - 1794617
Alignment:
| Q |
7 |
gagagaagaaaaactaattagatgaataatttagcggggaaagaatggtcttaaaccaccccttatcaagtggttgaagaaggtgaagaggaaaagagaa |
106 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1794919 |
gagaaaagaaaaactaattagatggataatttagcggggaaagaatggtcttaaaccaccccttatcaagtggttgaagaaggtgaagaggaaaagagaa |
1794820 |
T |
 |
| Q |
107 |
aagaaggatgcggctacgatactatttattgttttggtgattccatttccatgtgatgggttcatgccatggagacttgttttatgagagcttgagcata |
206 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1794819 |
aagaagggtgcggctacgatactatttattgttttggtgattccatttccatgtaatgggttcatgccatggagacttgttttatgagagcttgagcata |
1794720 |
T |
 |
| Q |
207 |
tatgttctcagaattgtatgttccctttccttaagaagatga-nnnnnnnnngtggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||| |||| ||||||||||||||||||| |||||||||| || ||||||| | ||||||||| ||||| ||| ||||||||||||||||| |
|
|
| T |
1794719 |
tatcttctgagaattgtatgttcccttttcttaagaagacgattttttttttgtggtggtcgaggtttgaaccccggatcttgcatatattatgcattgt |
1794620 |
T |
 |
| Q |
306 |
cca |
308 |
Q |
| |
|
||| |
|
|
| T |
1794619 |
cca |
1794617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 42045362 - 42045412
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
42045362 |
gtggtggccggggtttgaactccagaccttgcatatattatgcattgtcca |
42045412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 303
Target Start/End: Original strand, 49431983 - 49432028
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcatt |
303 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49431983 |
gtggtggccggggtttgaaccccggaccttacatatattatgcatt |
49432028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 270 - 305
Target Start/End: Complemental strand, 23045250 - 23045215
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
23045250 |
gtttgaactccggaccttacatatattatgcattgt |
23045215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 8736506 - 8736456
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
8736506 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtcca |
8736456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 34521180 - 34521230
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
34521180 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcattgtcca |
34521230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 45139996 - 45140046
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||| ||||| ||||||| |||||||||||||||||||| |
|
|
| T |
45139996 |
gtggtggccggggtttaaactctggaccttgcatatattatgcattgtcca |
45140046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 269 - 306
Target Start/End: Complemental strand, 39492381 - 39492344
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39492381 |
ggtttgaacttcggaccttacatatattatgcattgtc |
39492344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 41973326 - 41973277
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| ||||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
41973326 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcattgtcc |
41973277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 43356506 - 43356457
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||| | ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43356506 |
gtggtggtcggggtttgaactccaaaccttacatatattatgcattgtcc |
43356457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 268 - 305
Target Start/End: Complemental strand, 44243934 - 44243897
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44243934 |
gggtttgaactctggaccttacatatattatgcattgt |
44243897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 13590171 - 13590131
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
13590171 |
gggtttgaactccgaaccttacatattttatgcattgtcca |
13590131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 25533034 - 25532994
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
25533034 |
gggtttgaaccccggaccttgcatatattatgcattgtcca |
25532994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 305
Target Start/End: Original strand, 32950762 - 32950798
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32950762 |
ggtttgaactccggaccttgcatatattatgcattgt |
32950798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 304
Target Start/End: Original strand, 42440148 - 42440184
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattg |
304 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42440148 |
gggtttgaactccagaccttacatatattatgcattg |
42440184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 272 - 307
Target Start/End: Original strand, 2817377 - 2817412
Alignment:
| Q |
272 |
ttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2817377 |
ttgaacttcggaccttacatatattatgcattgtcc |
2817412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 258 - 305
Target Start/End: Original strand, 3528459 - 3528506
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||| ||| |||||| |||||||||||||||||||| |||||| |
|
|
| T |
3528459 |
gtggtggccggggcttgaacaccggaccttacatatattatacattgt |
3528506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 307
Target Start/End: Original strand, 33153880 - 33153919
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33153880 |
gggtttgaacctcggaccttacatatattatgcattgtcc |
33153919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 307
Target Start/End: Original strand, 64679 - 64717
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
64679 |
ggtttgaactccggactttgcatatattatgcattgtcc |
64717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 307
Target Start/End: Original strand, 9639818 - 9639856
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
9639818 |
ggttcgaactccggaccttgcatatattatgcattgtcc |
9639856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 268 - 306
Target Start/End: Complemental strand, 13401658 - 13401620
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
13401658 |
gggtttgaaccccgaaccttacatatattatgcattgtc |
13401620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 278 - 308
Target Start/End: Original strand, 29999364 - 29999394
Alignment:
| Q |
278 |
tccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29999364 |
tccggaccttacatatattatgcattgtcca |
29999394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 40734995 - 40735045
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| | |||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
40734995 |
gtggtggtcagggtttgaaccccgaaccttacatattttatgcattgtcca |
40735045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 278 - 308
Target Start/End: Complemental strand, 40948969 - 40948939
Alignment:
| Q |
278 |
tccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40948969 |
tccggaccttacatatattatgcattgtcca |
40948939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 44641598 - 44641548
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| || ||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
44641598 |
gtggtggccaggatttgaaccccgggccttgcatatattatgcattgtcca |
44641548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 307
Target Start/End: Complemental strand, 47417843 - 47417805
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
47417843 |
ggtttgaactccgaaccttgcatatattatgcattgtcc |
47417805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 3481632 - 3481587
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcatt |
303 |
Q |
| |
|
||||||||| |||||||||| || |||||| ||||||||||||||| |
|
|
| T |
3481632 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcatt |
3481587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 271 - 308
Target Start/End: Complemental strand, 4302510 - 4302473
Alignment:
| Q |
271 |
tttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
4302510 |
tttgaactccggatcttgcatatattatgcattgtcca |
4302473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 5907870 - 5907821
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||| || |||||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
5907870 |
gtggtgtccggggtttgaaccctggaccttgcatatattatgcattgtcc |
5907821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 6000133 - 6000182
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||| || |||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
6000133 |
gtggtgtccggggtttgaacctcggaccttgcatatattatgcattgtcc |
6000182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 8269358 - 8269407
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||| | |||||||||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
8269358 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgtattgtcc |
8269407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 268 - 305
Target Start/End: Original strand, 12268984 - 12269021
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
12268984 |
gggtttgaaccccggaccttgcatatattatgcattgt |
12269021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 16033440 - 16033489
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| | |||||||| || |||||| ||||||||||||||||||| |
|
|
| T |
16033440 |
gtggtggccggagtttgaaccccagaccttgcatatattatgcattgtcc |
16033489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 17139507 - 17139556
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||| | |||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
17139507 |
gtggtggtcggggtttgaaccccggaccttgaatatattatgcattgtcc |
17139556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 27533314 - 27533265
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||| | |||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
27533314 |
gtggtggtcggggtttgaaccccgaaccttgcatatattatgcattgtcc |
27533265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 34595943 - 34595898
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcatt |
303 |
Q |
| |
|
||||||||| ||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
34595943 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcatt |
34595898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 45677356 - 45677311
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcatt |
303 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
45677356 |
gtggtggccggggtttgaactccaaaccttacatatgttatgcatt |
45677311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 270 - 303
Target Start/End: Original strand, 48131230 - 48131263
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcatt |
303 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
48131230 |
gtttgaactccagaccttacatatattatgcatt |
48131263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Original strand, 26803451 - 26803491
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
26803451 |
gggtttgaaccccggactttgcatatattatgcattgtcca |
26803491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 279 - 307
Target Start/End: Complemental strand, 41926872 - 41926844
Alignment:
| Q |
279 |
ccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41926872 |
ccggaccttacatatattatgcattgtcc |
41926844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 306
Target Start/End: Original strand, 52441501 - 52441549
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||||| ||||| ||| ||||||||| |||||||||||||||||| |
|
|
| T |
52441501 |
gtggtggccggggttcaaacgccggaccttgcatatattatgcattgtc |
52441549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 47)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 258 - 305
Target Start/End: Original strand, 19260569 - 19260616
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19260569 |
gtggtggccggggtttgaaccccggaccttacatatattatgcattgt |
19260616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 6038265 - 6038315
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| | ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6038265 |
gtggtggccggagtttgaactccagaccttacatatattatgcattgtcca |
6038315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 12748972 - 12748922
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
12748972 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtcca |
12748922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 32051522 - 32051572
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
32051522 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtcca |
32051572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 20665353 - 20665402
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
20665353 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
20665402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 30550716 - 30550765
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
30550716 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
30550765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 44215465 - 44215514
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
44215465 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
44215514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 258 - 305
Target Start/End: Complemental strand, 9241086 - 9241039
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9241086 |
gtggtggccggggtttgaacatcggaccttacatatattatgcattgt |
9241039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 6235541 - 6235591
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
6235541 |
gtggtggccggggtttgaatcccggaccttacatatattatgcatcgtcca |
6235591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 22775699 - 22775649
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||||||||| |||| ||||||||||||||| |
|
|
| T |
22775699 |
gtggtggccagggtttgaaccccggaccttgcataaattatgcattgtcca |
22775649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 270 - 308
Target Start/End: Original strand, 27718896 - 27718934
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27718896 |
gtttgaactccggaccttgcatatattatgcattgtcca |
27718934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 306
Target Start/End: Complemental strand, 44794962 - 44794916
Alignment:
| Q |
260 |
ggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44794962 |
ggtggccgaggtttgaactccggaccttgcatatattatgcattgtc |
44794916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 444484 - 444435
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||| ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
444484 |
gtggtggccggggtttaaaccccggaccttgcatatattatgcattgtcc |
444435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 3650591 - 3650546
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcatt |
303 |
Q |
| |
|
||||||||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
3650591 |
gtggtggccggggtttgaaccccgaaccttacatatattatgcatt |
3650546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 271 - 308
Target Start/End: Complemental strand, 6447247 - 6447210
Alignment:
| Q |
271 |
tttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6447247 |
tttgaactccggaccttgcatatattatgcattgtcca |
6447210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 8881346 - 8881297
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
8881346 |
gtggtggccggggtttgaaccctggaccttgcatatattatgcattgtcc |
8881297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 24838160 - 24838209
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
24838160 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtcc |
24838209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 27587292 - 27587243
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||| ||||||||| ||||||| ||||||||||| |
|
|
| T |
27587292 |
gtggtggccggggtttgaaccccggaccttgcatatatcatgcattgtcc |
27587243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 274 - 306
Target Start/End: Complemental strand, 574439 - 574407
Alignment:
| Q |
274 |
gaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
574439 |
gaactccggaccttacatatattatgcattgtc |
574407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 308
Target Start/End: Original strand, 11040419 - 11040459
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
11040419 |
gggtttgaacttcggaccttacatattttatgcattgtcca |
11040459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 307
Target Start/End: Complemental strand, 11709056 - 11709008
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||| | ||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
11709056 |
tggtggtcggggtttgaacttcggaccttgcatatattatgcattgtcc |
11709008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 307
Target Start/End: Complemental strand, 39821950 - 39821906
Alignment:
| Q |
263 |
ggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||||||||| || |||||| ||||||||||||||||||| |
|
|
| T |
39821950 |
ggcctgggtttgaaccccagaccttgcatatattatgcattgtcc |
39821906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 307
Target Start/End: Original strand, 8461836 - 8461875
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
8461836 |
gggtttgaactccggaccttgcatattttatgcattgtcc |
8461875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 258 - 305
Target Start/End: Original strand, 9192217 - 9192264
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||| |||||||||| || ||| |||||||||||||||||||| |
|
|
| T |
9192217 |
gtggtggccggggtttgaaccccagactttacatatattatgcattgt |
9192264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 259 - 298
Target Start/End: Complemental strand, 29293247 - 29293208
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattat |
298 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
29293247 |
tggtggccggagtttgaactccggaccttacatatattat |
29293208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 269 - 308
Target Start/End: Original strand, 32115407 - 32115446
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
32115407 |
ggtttgaaccccgaaccttacatatattatgcattgtcca |
32115446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 258 - 305
Target Start/End: Complemental strand, 41603132 - 41603085
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||||| |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
41603132 |
gtggtggcaagggtttgaaccccagaccttacatatattatgcattgt |
41603085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 268 - 306
Target Start/End: Complemental strand, 11670812 - 11670774
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
11670812 |
gggttcgaactccggaccttacatatattatgtattgtc |
11670774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 12800890 - 12800940
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| | |||||||||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
12800890 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgtattgtcca |
12800940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 19163526 - 19163576
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| | |||||||||| ||||||||| |||| ||||||||||||||| |
|
|
| T |
19163526 |
gtggtggtcggggtttgaaccccggaccttgcataaattatgcattgtcca |
19163576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 29376972 - 29376922
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| | ||||||||||||| |||||| ||||||||| |||||||||| |
|
|
| T |
29376972 |
gtggtggtcggggtttgaactccagaccttgcatatattacgcattgtcca |
29376922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 37141428 - 37141378
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| | |||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
37141428 |
gtggtggccggagtttgaaccccgaaccttgcatatattatgcattgtcca |
37141378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 275 - 305
Target Start/End: Original strand, 38594437 - 38594467
Alignment:
| Q |
275 |
aactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38594437 |
aactccggaccttacatatattatgcattgt |
38594467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 38763505 - 38763555
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||| |||| || |||||| |||||||||||||||||||| |
|
|
| T |
38763505 |
gtggtggccagggttcgaaccccagaccttgcatatattatgcattgtcca |
38763555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 268 - 306
Target Start/End: Original strand, 42172243 - 42172281
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
42172243 |
gggtttgaactccggatcttgcatatattatgcattgtc |
42172281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 274 - 308
Target Start/End: Complemental strand, 44602652 - 44602618
Alignment:
| Q |
274 |
gaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
44602652 |
gaactccggaccttgcatatattatgcattgtcca |
44602618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 308
Target Start/End: Original strand, 5208185 - 5208233
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| |||||||||| ||| ||||||||||||||||| |||||||| |
|
|
| T |
5208185 |
tggtggcc-gggtttgaaccccgtaccttacatatattatgtattgtcca |
5208233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 308
Target Start/End: Original strand, 8717466 - 8717515
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| ||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
8717466 |
tggtggccgaggtttgaaccccgaaccttgcatatattatgcattgtcca |
8717515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 268 - 305
Target Start/End: Complemental strand, 33105452 - 33105415
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
33105452 |
gggtttgaaccccggaccttgcatatattatgcattgt |
33105415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Complemental strand, 42233142 - 42233101
Alignment:
| Q |
262 |
tggcctgggtttgaactccggaccttacatatattatgcatt |
303 |
Q |
| |
|
||||| |||||| |||||| |||||||||||||||||||||| |
|
|
| T |
42233142 |
tggccggggtttaaactccagaccttacatatattatgcatt |
42233101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 280 - 308
Target Start/End: Complemental strand, 21557482 - 21557454
Alignment:
| Q |
280 |
cggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21557482 |
cggaccttacatatattatgcattgtcca |
21557454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 306
Target Start/End: Original strand, 27426676 - 27426724
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||||| ||||||||||||| |||||| |||| |||||||||||| |
|
|
| T |
27426676 |
gtggtggccggggtttgaactcccgaccttgtatattttatgcattgtc |
27426724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 269 - 305
Target Start/End: Complemental strand, 29652278 - 29652242
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
29652278 |
ggtttgaactctggaccttgcatatattatgcattgt |
29652242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 302
Target Start/End: Original strand, 30176409 - 30176453
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcat |
302 |
Q |
| |
|
|||||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
30176409 |
gtggtgtccggggtttgaaccccggaccttgcatatattatgcat |
30176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Original strand, 33373752 - 33373792
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| || |||||||||||||||||| |||||||| |
|
|
| T |
33373752 |
gggtttgaaccccagaccttacatatattatgaattgtcca |
33373792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 306
Target Start/End: Original strand, 35843118 - 35843166
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacata-tattatgcattgtc |
306 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| | |||||||||||| |
|
|
| T |
35843118 |
tggtggccggggtttgaaccccggaccttacatatttttatgcattgtc |
35843166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 306
Target Start/End: Original strand, 44632175 - 44632223
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||| | |||||||||| ||| |||||| ||||||||||||||||| |
|
|
| T |
44632175 |
gtggtggtcggggtttgaaccccgaaccttatatatattatgcattgtc |
44632223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 39)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 260 - 307
Target Start/End: Complemental strand, 28898925 - 28898878
Alignment:
| Q |
260 |
ggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28898925 |
ggtggccggggtttgaactccggacctttcatatattatgcattgtcc |
28898878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 8569780 - 8569730
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
8569780 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtcca |
8569730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 247730 - 247681
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
247730 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
247681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 259 - 307
Target Start/End: Complemental strand, 16390499 - 16390451
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16390499 |
tggtggccgaggtttgaaccccggaccttacatatattatgcattgtcc |
16390451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 11456366 - 11456415
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
11456366 |
gtggtggccggggtttgaaccccg-accttacatatattatgcattgtcca |
11456415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 14296947 - 14296997
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
14296947 |
gtggtggccggggtttgaaccccggaccttacatattttatgtattgtcca |
14296997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 24623307 - 24623357
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| | |||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
24623307 |
gtggtggtcggggtttgaaccccgaaccttacatatattatgcattgtcca |
24623357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 25165348 - 25165298
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| ||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
25165348 |
gtggtggctggggttcgaacgccggaccttacatatattatgcattgtcca |
25165298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 29740553 - 29740503
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||||||||| | |||||||||||||||||| |
|
|
| T |
29740553 |
gtggtggccggggtttgaaccccggaccttgcgtatattatgcattgtcca |
29740503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 788937 - 788888
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||| | |||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
788937 |
gtggtggtcggggtttgaactccgaaccttgcatatattatgcattgtcc |
788888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 259 - 308
Target Start/End: Complemental strand, 10053320 - 10053271
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||| ||| |||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
10053320 |
tggtggtctgagtttgaactccgaactttacatatattatgcattgtcca |
10053271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 12582219 - 12582268
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| ||||||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
12582219 |
gtggtggccggggtttgaactccagaccttgcatattttatgcattgtcc |
12582268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 268 - 305
Target Start/End: Complemental strand, 13496177 - 13496140
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13496177 |
gggtttgaactccggaccttgcatatattatgcattgt |
13496140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 307
Target Start/End: Complemental strand, 33824951 - 33824903
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| ||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
33824951 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcattgtcc |
33824903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 258 - 305
Target Start/End: Complemental strand, 15170002 - 15169955
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||| | |||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
15170002 |
gtggtggtcggggtttgaaccccgaaccttacatatattatgcattgt |
15169955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 258 - 305
Target Start/End: Complemental strand, 15178774 - 15178727
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||| | |||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
15178774 |
gtggtggtcggggtttgaaccccgaaccttacatatattatgcattgt |
15178727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 270 - 305
Target Start/End: Original strand, 23635716 - 23635751
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23635716 |
gtttgaactccgaaccttacatatattatgcattgt |
23635751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 307
Target Start/End: Original strand, 2655020 - 2655066
Alignment:
| Q |
261 |
gtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||| |||||||||| ||||| ||||||||| ||||||||||||| |
|
|
| T |
2655020 |
gtggccggggtttgaaccccggatcttacatattttatgcattgtcc |
2655066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 2726407 - 2726457
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||| || ||||| |||| ||||||||| |||||||||||||||||||| |
|
|
| T |
2726407 |
gtggtgaccggggttcgaaccccggaccttgcatatattatgcattgtcca |
2726457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 278 - 308
Target Start/End: Original strand, 16276703 - 16276733
Alignment:
| Q |
278 |
tccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16276703 |
tccggaccttacatatattatgcattgtcca |
16276733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 306
Target Start/End: Original strand, 655742 - 655787
Alignment:
| Q |
261 |
gtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
|||||| ||||| |||| ||||||||| |||||||||||||||||| |
|
|
| T |
655742 |
gtggccggggttcgaaccccggaccttgcatatattatgcattgtc |
655787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 7082982 - 7083031
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| ||||||||||||| || ||| ||||||||||||||||||| |
|
|
| T |
7082982 |
gtggtggctggggtttgaactccagatcttgcatatattatgcattgtcc |
7083031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 8916464 - 8916513
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| | ||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
8916464 |
gtggtggccgagatttgaactccggaccttgcatatattatgtattgtcc |
8916513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 10018470 - 10018425
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcatt |
303 |
Q |
| |
|
||||||||| | |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
10018470 |
gtggtggccggagtttgaaccccgaaccttacatatattatgcatt |
10018425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 14610051 - 14610003
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
14610051 |
gtggtggccggggtttgaac-ccggaccttacatatattatagattgtcc |
14610003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 308
Target Start/End: Original strand, 20720792 - 20720821
Alignment:
| Q |
279 |
ccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20720792 |
ccggaccttacatatattatgcattgtcca |
20720821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 28231415 - 28231464
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| | || ||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
28231415 |
gtggtggccggagtgtgaaccccggaccttgcatatattatgcattgtcc |
28231464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 307
Target Start/End: Complemental strand, 33976311 - 33976266
Alignment:
| Q |
262 |
tggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||| |||||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
33976311 |
tggccggggtttgaaccccggaccttgcatattttatgcattgtcc |
33976266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 280 - 308
Target Start/End: Original strand, 1794963 - 1794991
Alignment:
| Q |
280 |
cggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1794963 |
cggaccttacatatattatgcattgtcca |
1794991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 306
Target Start/End: Complemental strand, 4826361 - 4826313
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||||| | |||||||| || |||||||||||||||||||||||| |
|
|
| T |
4826361 |
gtggtggccggagtttgaacctcgaaccttacatatattatgcattgtc |
4826313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 269 - 305
Target Start/End: Original strand, 8138459 - 8138495
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||| |
|
|
| T |
8138459 |
ggtttgaaccccagaccttacatatattatgcattgt |
8138495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 10495802 - 10495838
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatata |
294 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
10495802 |
gtggtggccagggtttgaaccccggaccttacatata |
10495838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 272 - 308
Target Start/End: Complemental strand, 11982608 - 11982572
Alignment:
| Q |
272 |
ttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
11982608 |
ttgaactccggaccttgcatatattatgtattgtcca |
11982572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Original strand, 13044614 - 13044654
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||| |||| |||||||| |||||||||||||||||||| |
|
|
| T |
13044614 |
gggtttaaacttcggaccttccatatattatgcattgtcca |
13044654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 270 - 306
Target Start/End: Complemental strand, 15522481 - 15522445
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
15522481 |
gtttgaactctggaccttacatattttatgcattgtc |
15522445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 20744199 - 20744159
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
20744199 |
gggtttgaaccccagaccttgcatatattatgcattgtcca |
20744159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 306
Target Start/End: Original strand, 24373700 - 24373748
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
|||||||| |||||||||| || |||||| |||||||||||||||||| |
|
|
| T |
24373700 |
gtggtggctggggtttgaacccctgaccttgcatatattatgcattgtc |
24373748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 269 - 305
Target Start/End: Original strand, 24570508 - 24570544
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
24570508 |
ggtttgaactacggaccttacatatagtatgcattgt |
24570544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 302
Target Start/End: Complemental strand, 32621443 - 32621399
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcat |
302 |
Q |
| |
|
||||||| | ||||||||| |||||||||||||||||||||||| |
|
|
| T |
32621443 |
gtggtggtcggggtttgaatcccggaccttacatatattatgcat |
32621399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0350 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0350
Description:
Target: scaffold0350; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 1319 - 1269
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| | ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1319 |
gtggtggccggagtttgaactccagaccttacatatattatgcattgtcca |
1269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 44)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 27462426 - 27462476
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
27462426 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtcca |
27462476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 20763225 - 20763176
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
20763225 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
20763176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 27833391 - 27833440
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27833391 |
gtggtggtcggggtttgaaccccggaccttacatatattatgcattgtcc |
27833440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 29488791 - 29488742
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
29488791 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
29488742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 33232387 - 33232436
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
33232387 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
33232436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 34284529 - 34284578
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
34284529 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
34284578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 307
Target Start/End: Original strand, 26713094 - 26713133
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26713094 |
gggtttaaactccggaccttacatatattatgcattgtcc |
26713133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 10244797 - 10244748
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
10244797 |
gtggtggcc-gggtttgaaccccggaccttgcatatattatgcattgtcca |
10244748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 18773746 - 18773796
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
18773746 |
gtggtggtcggggtttgaaccccggaccttacatattttatgcattgtcca |
18773796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 19416585 - 19416535
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
19416585 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtcca |
19416535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 23413036 - 23413086
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| | ||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
23413036 |
gtggtggcccgagtttgaactcccgaccttgcatatattatgcattgtcca |
23413086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 270 - 308
Target Start/End: Original strand, 47342436 - 47342474
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47342436 |
gtttgaactccggaccttgcatatattatgcattgtcca |
47342474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 259 - 308
Target Start/End: Complemental strand, 4905346 - 4905297
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
4905346 |
tggtggccggggtttgaactccgaaccttgcatattttatgcattgtcca |
4905297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 33610915 - 33610964
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| | ||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
33610915 |
gtggtggccggtgttcgaactccggaccttgcatatattatgcattgtcc |
33610964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 268 - 305
Target Start/End: Original strand, 43539104 - 43539141
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43539104 |
gggtttgaaccccggaccttacatatattatgcattgt |
43539141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 48527261 - 48527212
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| || || |||||||||||||| ||||||||||||||||||| |
|
|
| T |
48527261 |
gtggtggccgggattcgaactccggaccttgcatatattatgcattgtcc |
48527212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 307
Target Start/End: Original strand, 19036093 - 19036141
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| ||||||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
19036093 |
tggtggccggggtttgaactccagaccttgcatattttatgcattgtcc |
19036141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 19599206 - 19599166
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
19599206 |
gggtttgaaccccggaccttgcatatattatgcattgtcca |
19599166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 307
Target Start/End: Complemental strand, 20718543 - 20718495
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| ||||||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
20718543 |
tggtggccggggtttgaactccagaccttgcatattttatgcattgtcc |
20718495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 308
Target Start/End: Original strand, 34448610 - 34448650
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
34448610 |
gggtttgaaccctggaccttacatatattatgcattgtcca |
34448650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 258 - 305
Target Start/End: Complemental strand, 3671895 - 3671848
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||| | ||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
3671895 |
gtggtggtcggggtttgaactccagaccttgcatatattatgcattgt |
3671848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 307
Target Start/End: Complemental strand, 18714509 - 18714470
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
18714509 |
gggtttgaaccccggaccttgcatatattatgcattgtcc |
18714470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 261 - 308
Target Start/End: Original strand, 19626518 - 19626565
Alignment:
| Q |
261 |
gtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||| | |||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
19626518 |
gtggccggtgtttgaaccccggaccttgcatatattatgcattgtcca |
19626565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 258 - 305
Target Start/End: Complemental strand, 30753797 - 30753750
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||| | ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
30753797 |
gtggtggccggagtttgaactccagaccttacatattttatgcattgt |
30753750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 269 - 308
Target Start/End: Original strand, 37516803 - 37516842
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
37516803 |
ggtttgaactccggaccttgcatatgttatgcattgtcca |
37516842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 261 - 308
Target Start/End: Complemental strand, 46737853 - 46737806
Alignment:
| Q |
261 |
gtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||| | |||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
46737853 |
gtggccggtgtttgaaccccggaccttgcatatattatgcattgtcca |
46737806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 8084498 - 8084448
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||| |||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
8084498 |
gtggtggccggggttcgaaccccggaccttgcatattttatgcattgtcca |
8084448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 268 - 306
Target Start/End: Original strand, 20085759 - 20085797
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
20085759 |
gggtttgaaccccggaccttgcatatattatgcattgtc |
20085797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 25288735 - 25288685
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| || ||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
25288735 |
gtggtggctgggatttgaactccggaccttgcatatcttatgcattgtcca |
25288685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 3830139 - 3830090
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| |||||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
3830139 |
gtggtggctggggtttgaaccctggaccttgcatatattatgcattgtcc |
3830090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 7388029 - 7388078
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||| | ||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
7388029 |
gtggtggtcggggtttgaatcccgaaccttacatatattatgcattgtcc |
7388078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 7872738 - 7872787
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||| |||||||| |||| || |||||| ||||||||||||||||||| |
|
|
| T |
7872738 |
gtggtgtcctgggttcgaaccccagaccttgcatatattatgcattgtcc |
7872787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 308
Target Start/End: Complemental strand, 27263411 - 27263362
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| ||||| |||||||| ||||| |||||||||||||||||||| |
|
|
| T |
27263411 |
tggtggctggggttcgaactccgaaccttgcatatattatgcattgtcca |
27263362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 33473511 - 33473560
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| ||||| |||| | ||||||| ||||||||||||||||||| |
|
|
| T |
33473511 |
gtggtggccagggttggaaccctggaccttgcatatattatgcattgtcc |
33473560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 42829224 - 42829273
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| | |||||||| ||||| ||| ||||||||||||||||||| |
|
|
| T |
42829224 |
gtggtggccggagtttgaaccccggagcttgcatatattatgcattgtcc |
42829273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 271 - 308
Target Start/End: Original strand, 44868158 - 44868195
Alignment:
| Q |
271 |
tttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44868158 |
tttgaacctcggaccttacatatattatgcattgtcca |
44868195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 46987157 - 46987108
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||| || ||||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
46987157 |
gtggtgtccggggttcgaaccccggaccttgcatatattatgcattgtcc |
46987108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 269 - 305
Target Start/End: Complemental strand, 7670494 - 7670458
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
7670494 |
ggtttgaaccccggaccttgcatatattatgcattgt |
7670458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 306
Target Start/End: Complemental strand, 31414169 - 31414121
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||| | ||||||||||||| |||| ||||||||||||| |||||| |
|
|
| T |
31414169 |
gtggtggtcggggtttgaactccagaccctacatatattatgtattgtc |
31414121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 305
Target Start/End: Original strand, 34722010 - 34722058
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacata-tattatgcattgt |
305 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
34722010 |
gtggtggcctgggttcgaacctcggaccttacatattattatgcattgt |
34722058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Original strand, 43346564 - 43346604
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| | ||||| |||||||||||||||||||||||| |
|
|
| T |
43346564 |
gggtttgatccccggatcttacatatattatgcattgtcca |
43346604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 306
Target Start/End: Original strand, 46849097 - 46849145
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||| | ||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
46849097 |
gtggtggtcggggtttgaactccaaactttacatatattatgcattgtc |
46849145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 306
Target Start/End: Original strand, 48007537 - 48007585
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
|||||| |||||||| |||||| |||||| |||||||||||||||||| |
|
|
| T |
48007537 |
gtggtgtcctgggttcaaactccagaccttgcatatattatgcattgtc |
48007585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 307
Target Start/End: Original strand, 48629056 - 48629104
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||| | |||||| ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
48629056 |
tggtggtcggggtttaaaccccggaccttgcatatattatgcattgtcc |
48629104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 44)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 20688111 - 20688061
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| | |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20688111 |
gtggtggccagagtttgaactccggaccttgcatatattatgcattgtcca |
20688061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 22522791 - 22522841
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
22522791 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtcca |
22522841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 26655535 - 26655485
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
26655535 |
gtggtggccggggttcgaaccccggaccttacatatattatgcattgtcca |
26655485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 26927120 - 26927070
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
26927120 |
gtggtggccggggttcgaaccccggaccttacatatattatgcattgtcca |
26927070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 40715939 - 40715989
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
40715939 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtcca |
40715989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 37462182 - 37462133
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
37462182 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
37462133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 258 - 298
Target Start/End: Original strand, 25861937 - 25861977
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattat |
298 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25861937 |
gtggtggccggggtttgaactccggaccttacatatattat |
25861977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 6624847 - 6624797
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||| |||| ||||||||| |||||||||||||||||||| |
|
|
| T |
6624847 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcattgtcca |
6624797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 16575312 - 16575362
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16575312 |
gtggtggtcagggtttgaactccggaccttacatatattatatattgtcca |
16575362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 37932401 - 37932351
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||| |||| ||||||||| |||||||||||||||||||| |
|
|
| T |
37932401 |
gtggtggccagggttcgaaccccggaccttgcatatattatgcattgtcca |
37932351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 269 - 306
Target Start/End: Original strand, 4763187 - 4763224
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4763187 |
ggtttgaaccccggaccttacatatattatgcattgtc |
4763224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 6489078 - 6489029
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||| || |||||| ||||||||||||||||||| |
|
|
| T |
6489078 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtcc |
6489029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 303
Target Start/End: Original strand, 17083583 - 17083628
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcatt |
303 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17083583 |
gtggtggctggggtttgaactccagaccttacatatattatgcatt |
17083628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 259 - 308
Target Start/End: Complemental strand, 26409323 - 26409274
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||| | ||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
26409323 |
tggtgggcggggttcgaaccccggaccttacatatattatgcattgtcca |
26409274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 32565595 - 32565550
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcatt |
303 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
32565595 |
gtggtggccaaggtttgaacttcggaccttacatatattatgcatt |
32565550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 270 - 306
Target Start/End: Original strand, 31305888 - 31305924
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31305888 |
gtttgaacttcggaccttacatatattatgcattgtc |
31305924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 261 - 308
Target Start/End: Complemental strand, 42515876 - 42515828
Alignment:
| Q |
261 |
gtggcctgggtttgaa-ctccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||| ||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
42515876 |
gtggccggggtttgaatccccggaccttacatatattatgcattgtcca |
42515828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 267 - 306
Target Start/End: Original strand, 8882398 - 8882437
Alignment:
| Q |
267 |
tgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
8882398 |
tgggtttgaaccccggaccttacatatattatgcactgtc |
8882437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 269 - 308
Target Start/End: Original strand, 17239382 - 17239421
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17239382 |
ggttcgaactccggcccttacatatattatgcattgtcca |
17239421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 258 - 305
Target Start/End: Original strand, 34767178 - 34767225
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
34767178 |
gtggtggccggggtttgaacttcggaccttacatattttatgtattgt |
34767225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 18331778 - 18331728
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||| |||||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
18331778 |
gtggtggccggggcttgaaccccggaccttgcatattttatgcattgtcca |
18331728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 22665193 - 22665243
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||||||||| ||| ||||| |||| ||||||||| |
|
|
| T |
22665193 |
gtggtggccggggtttgaactccggatcttgcatattttatacattgtcca |
22665243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 29695086 - 29695036
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| | |||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
29695086 |
gtggtggtcggggtttgaaccacgaaccttacatatattatgcattgtcca |
29695036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 307
Target Start/End: Complemental strand, 34191501 - 34191455
Alignment:
| Q |
261 |
gtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||| |||||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
34191501 |
gtggccggggtttgaaccccggaccttgcatattttatgcattgtcc |
34191455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 35413027 - 35412978
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||| |||| ||||||||| |||||||||||||||||||| |
|
|
| T |
35413027 |
gtggtggccggggttcgaac-ccggaccttgcatatattatgcattgtcca |
35412978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 39980579 - 39980529
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| | |||||||||||||||||||| ||||| ||||||||| |||| |
|
|
| T |
39980579 |
gtggtggtcggggtttgaactccggaccttgcatattttatgcattatcca |
39980529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 2053097 - 2053048
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| ||||| |||||||||||||| |||| ||||||||||||| |
|
|
| T |
2053097 |
gtggtggccagggttcgaactccggaccttgtatattttatgcattgtcc |
2053048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 3445237 - 3445286
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| || ||||||| ||||||||| |||| |||||||||||||| |
|
|
| T |
3445237 |
gtggtggccgggatttgaaccccggaccttgcatacattatgcattgtcc |
3445286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 274 - 307
Target Start/End: Original strand, 8544995 - 8545028
Alignment:
| Q |
274 |
gaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
8544995 |
gaactccggaccttgcatatattatgcattgtcc |
8545028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 11720964 - 11720916
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
11720964 |
gtggtggccggggtttgaaccccg-accttgcatatattatgcattgtcc |
11720916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 268 - 305
Target Start/End: Complemental strand, 13409611 - 13409574
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13409611 |
gggtttgaactccggaccttgtatatattatgcattgt |
13409574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 34436922 - 34436873
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||| | |||||||||| |||| |||| ||||||||||||||||||| |
|
|
| T |
34436922 |
gtggtgggcggggtttgaaccccggcccttgcatatattatgcattgtcc |
34436873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 34702561 - 34702512
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| || || |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
34702561 |
gtggtggccaggattcgaaccccggacctttcatatattatgcattgtcc |
34702512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 270 - 307
Target Start/End: Complemental strand, 39963552 - 39963515
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
39963552 |
gtttgaaccccgaaccttacatatattatgcattgtcc |
39963515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 5614826 - 5614786
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||| |||| |
|
|
| T |
5614826 |
gggtttgaacccccgaccttacatatattatgcattatcca |
5614786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 8543637 - 8543597
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||||| |||||||| ||||| |||||||||||||| |
|
|
| T |
8543637 |
gggtttgaactacggacctttcatattttatgcattgtcca |
8543597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 12190053 - 12190013
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| || |||||||||||||||||| |||||||| |
|
|
| T |
12190053 |
gggtttgaacccccgaccttacatatattatgtattgtcca |
12190013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 270 - 306
Target Start/End: Complemental strand, 17230445 - 17230409
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| |
|
|
| T |
17230445 |
gtttgaactccgaatcttacatatattatgcattgtc |
17230409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 20721111 - 20721071
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
20721111 |
gggtttgaaccccggaccttgcatatattatgtattgtcca |
20721071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 307
Target Start/End: Original strand, 32200438 - 32200486
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||| | ||| |||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
32200438 |
tggtggtcggggcttgaaccccggaccttgcatatattatgcattgtcc |
32200486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 306
Target Start/End: Complemental strand, 32559375 - 32559327
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||||| || ||||||| || |||||||||||| |||||||||||| |
|
|
| T |
32559375 |
gtggtggccgggatttgaaccccagaccttacatattttatgcattgtc |
32559327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 307
Target Start/End: Complemental strand, 33928709 - 33928661
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| | |||| ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
33928709 |
tggtggccagagtttaaaccccggaccttgcatatattatgcattgtcc |
33928661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 269 - 305
Target Start/End: Complemental strand, 42473954 - 42473918
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
42473954 |
ggtttgaaccccggaccttgcatatattatgcattgt |
42473918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 274 - 306
Target Start/End: Complemental strand, 43396909 - 43396877
Alignment:
| Q |
274 |
gaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
43396909 |
gaacaccggaccttacatatattatgcattgtc |
43396877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 45)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 38130949 - 38130999
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
38130949 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtcca |
38130999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 916510 - 916461
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
916510 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
916461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 7464481 - 7464530
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7464481 |
gtggtggtcggggtttgaaccccggaccttacatatattatgcattgtcc |
7464530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 44075146 - 44075195
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
44075146 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
44075195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 45432019 - 45431970
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
45432019 |
gtggtggccagggtttgaaccccggaccttgcatatattatgcattgtcc |
45431970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 258 - 306
Target Start/End: Original strand, 48849753 - 48849801
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||||| |||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
48849753 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtc |
48849801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 4601915 - 4601865
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||||||||| ||| |||||||||||||||| |
|
|
| T |
4601915 |
gtggtggccggggtttgaaccccggaccttgcatttattatgcattgtcca |
4601865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 25340914 - 25340964
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
25340914 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcattgtcca |
25340964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 25441490 - 25441540
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
25441490 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtcca |
25441540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 307
Target Start/End: Original strand, 34442440 - 34442486
Alignment:
| Q |
261 |
gtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
34442440 |
gtggccggggtttgaaccccggaccttacatattttatgcattgtcc |
34442486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 41817570 - 41817520
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
41817570 |
gtggtggctagggtttgaaccccggaccttgcatatattatgcattgtcca |
41817520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 271 - 308
Target Start/End: Original strand, 977944 - 977981
Alignment:
| Q |
271 |
tttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
977944 |
tttgaactccggaccttgcatatattatgcattgtcca |
977981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 266 - 307
Target Start/End: Complemental strand, 13898912 - 13898871
Alignment:
| Q |
266 |
ctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
13898912 |
ctgggtttgaactccggaccttacatattttatgcgttgtcc |
13898871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 307
Target Start/End: Complemental strand, 34899167 - 34899119
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||| | |||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
34899167 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgtcc |
34899119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 270 - 305
Target Start/End: Complemental strand, 36690071 - 36690036
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36690071 |
gtttgaactccgaaccttacatatattatgcattgt |
36690036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 2153491 - 2153541
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||| ||| || |||||| |||||||||||||||||||| |
|
|
| T |
2153491 |
gtggtggccagggtttaaaccccagaccttgcatatattatgcattgtcca |
2153541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 274 - 308
Target Start/End: Complemental strand, 7827563 - 7827529
Alignment:
| Q |
274 |
gaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7827563 |
gaactccagaccttacatatattatgcattgtcca |
7827529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 10498685 - 10498735
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
10498685 |
gtggtggccgaggtttgaactcatgaccttgcatatattatgcattgtcca |
10498735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 307
Target Start/End: Complemental strand, 21245853 - 21245815
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
21245853 |
ggtttgaaccccagaccttacatatattatgcattgtcc |
21245815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 25727957 - 25728007
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| | || ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
25727957 |
gtggtggtcgggatttgaaccccggaccttgcatatattatgcattgtcca |
25728007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 305
Target Start/End: Original strand, 28965768 - 28965814
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||| || |||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
28965768 |
tggtgaccggggtttgaaccccgaaccttacatatattatgcattgt |
28965814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 29631257 - 29631207
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
29631257 |
gtggtggccggggtttgaatcccgaaccttgcatatattatgcattgtcca |
29631207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 32843252 - 32843302
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| || |||||| ||||| |||||||||||||| |
|
|
| T |
32843252 |
gtggtggccggggtttgaaccccagaccttgcatattttatgcattgtcca |
32843302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 268 - 306
Target Start/End: Original strand, 46226025 - 46226063
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
46226025 |
gggttcgaactccggaccttgcatatattatgcattgtc |
46226063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 46483318 - 46483268
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| ||||| ||||||||||| || |||||||||||||||||||| |
|
|
| T |
46483318 |
gtggtggctggggttcgaactccggactttgcatatattatgcattgtcca |
46483268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 270 - 308
Target Start/End: Complemental strand, 46903967 - 46903929
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
46903967 |
gtttgaaccctggaccttacatatattatgcattgtcca |
46903929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 48796208 - 48796258
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||| ||||| ||||| |||||||||||||| |
|
|
| T |
48796208 |
gtggtggccggggtttgaaccccgaaccttgcatatcttatgcattgtcca |
48796258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 51882190 - 51882240
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| | ||| ||| |||||||||||||||||||| |
|
|
| T |
51882190 |
gtggtggccggggtttgaaccctggatcttgcatatattatgcattgtcca |
51882240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 8238635 - 8238586
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| | |||||||| || |||||| ||||||||||||||||||| |
|
|
| T |
8238635 |
gtggtggccggagtttgaaccccagaccttgcatatattatgcattgtcc |
8238586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 308
Target Start/End: Complemental strand, 42269363 - 42269319
Alignment:
| Q |
263 |
ggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||| |||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
42269363 |
ggccggggtttgaactc-gaaccttacatatattatgcattgtcca |
42269319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 306
Target Start/End: Original strand, 48656900 - 48656937
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
48656900 |
ggtttgaaccccggaccttgcatatattatgcattgtc |
48656937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Original strand, 2186427 - 2186467
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| || |||||||||||||||||| |||||||| |
|
|
| T |
2186427 |
gggtttgaaccccagaccttacatatattatgtattgtcca |
2186467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 307
Target Start/End: Complemental strand, 5349598 - 5349550
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| |||||||||| |||||||| ||||||| ||||||||||| |
|
|
| T |
5349598 |
tggtggccagggtttgaacctcggaccttgcatatataatgcattgtcc |
5349550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 306
Target Start/End: Complemental strand, 8075856 - 8075808
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||||| |||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
8075856 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcattgtc |
8075808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 274 - 306
Target Start/End: Original strand, 8747242 - 8747274
Alignment:
| Q |
274 |
gaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
8747242 |
gaaccccggaccttacatatattatgcattgtc |
8747274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 306
Target Start/End: Complemental strand, 11358305 - 11358257
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||||| |||||||||| ||||| ||| ||||||||||| |||||| |
|
|
| T |
11358305 |
gtggtggccggggtttgaaccccggatcttgcatatattatgaattgtc |
11358257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 306
Target Start/End: Original strand, 12699995 - 12700043
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||||| | |||||||| |||||| |||||||| |||||||||||| |
|
|
| T |
12699995 |
gtggtggccggagtttgaaccccggactttacatattttatgcattgtc |
12700043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Original strand, 16663236 - 16663276
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||| |||| |
|
|
| T |
16663236 |
gggtttgaaccccggaccttgcatatattatgcattatcca |
16663276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 306
Target Start/End: Original strand, 16792964 - 16793012
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
|||||| || |||||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
16792964 |
gtggtgaccggggtttgaaccctggaccttgcatatattatgcattgtc |
16793012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 21160113 - 21160073
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||| |||| |
|
|
| T |
21160113 |
gggtttgaacccccgaccttacatatattatgcattatcca |
21160073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 275 - 307
Target Start/End: Complemental strand, 26973415 - 26973383
Alignment:
| Q |
275 |
aactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
26973415 |
aactccgaaccttacatatattatgcattgtcc |
26973383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 274 - 306
Target Start/End: Original strand, 33633324 - 33633356
Alignment:
| Q |
274 |
gaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
33633324 |
gaactccggatcttacatatattatgcattgtc |
33633356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 294
Target Start/End: Complemental strand, 36623492 - 36623456
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatata |
294 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
36623492 |
gtggtggccggggtttgaactccggaccttgcatata |
36623456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 39779085 - 39779045
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
39779085 |
gggtttgaaccccgaaccttgcatatattatgcattgtcca |
39779045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 307
Target Start/End: Complemental strand, 52119446 - 52119398
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| ||||| |||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
52119446 |
tggtggccggggttcgaaccccgaaccttgcatatattatgcattgtcc |
52119398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 75)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 10261759 - 10261808
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
10261759 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
10261808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 21562696 - 21562647
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
21562696 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
21562647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 26926700 - 26926749
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
26926700 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
26926749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 38375028 - 38374979
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| ||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
38375028 |
gtggtggccggggtttgaactccagaccttgcatatattatgcattgtcc |
38374979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 43330217 - 43330168
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
43330217 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
43330168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 49385296 - 49385345
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49385296 |
gtggtggccgaggtttgaactccggatcttacatatattatgcattgtcc |
49385345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 51450283 - 51450234
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
51450283 |
gtggtggccggggtttgaactccggaccttgcatatcttatgcattgtcc |
51450234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 8607188 - 8607148
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8607188 |
gggtttgaactccggaccttacatacattatgcattgtcca |
8607148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 43722826 - 43722786
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43722826 |
gggtttgaaccccggaccttacatatattatgcattgtcca |
43722786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 258 - 306
Target Start/End: Original strand, 49041971 - 49042019
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||||| |||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
49041971 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtc |
49042019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 269 - 308
Target Start/End: Original strand, 6459925 - 6459964
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6459925 |
ggttcgaactccggaccttacatatattatgcattgtcca |
6459964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 11198399 - 11198349
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| ||||||||| |||||||||||| ||||||| |
|
|
| T |
11198399 |
gtggtggccggggtttgaaccccggaccttgcatatattatgccttgtcca |
11198349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 11949753 - 11949803
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| | |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
11949753 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgcattgtcca |
11949803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 270 - 308
Target Start/End: Original strand, 16686174 - 16686212
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16686174 |
gtttgaactccggaccttacctatattatgcattgtcca |
16686212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 307
Target Start/End: Complemental strand, 29908116 - 29908078
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29908116 |
ggtttgaactccggaccttgcatatattatgcattgtcc |
29908078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 270 - 308
Target Start/End: Original strand, 49952571 - 49952609
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49952571 |
gtttgaaccccggaccttacatatattatgcattgtcca |
49952609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 271 - 305
Target Start/End: Original strand, 50380839 - 50380873
Alignment:
| Q |
271 |
tttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
50380839 |
tttgaactccggaccttacatatattatgcattgt |
50380873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 2649723 - 2649772
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| ||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
2649723 |
gtggtggctagggttcgaactccggaccttgcatatattatgcattgtcc |
2649772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 7230351 - 7230302
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| ||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
7230351 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcattgtcc |
7230302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 262 - 307
Target Start/End: Original strand, 14577501 - 14577546
Alignment:
| Q |
262 |
tggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||| ||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
14577501 |
tggccggggtttgaactccggactttgcatatattatgcattgtcc |
14577546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 20799384 - 20799433
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||| || |||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
20799384 |
gtggtgaccagggtttgaaccccggaccttgcatatattatgcattgtcc |
20799433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 24079830 - 24079879
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||| | |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
24079830 |
gtggtggtcggggtttgaactccggaccttgcatattttatgcattgtcc |
24079879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 56551582 - 56551631
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
56551582 |
gtggtggccggggtttgaacctcggaccttgcatatattatgcattgtcc |
56551631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 675979 - 675939
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
675979 |
gggtttgaaccccggaccttgcatatattatgcattgtcca |
675939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 897486 - 897446
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
897486 |
gggtttgaaccccggaccttacatatattatacattgtcca |
897446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 308
Target Start/End: Original strand, 14202479 - 14202519
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
14202479 |
gggtttgaaccccggaccttacatatattatgcattatcca |
14202519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 20383549 - 20383509
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
20383549 |
gggtttgaaccccggaccttgcatatattatgcattgtcca |
20383509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 270 - 306
Target Start/End: Complemental strand, 54500628 - 54500592
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
54500628 |
gtttgaaccccggaccttacatatattatgcattgtc |
54500592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 269 - 308
Target Start/End: Complemental strand, 281651 - 281612
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
281651 |
ggtttgaaccccggacctttcatatattatgcattgtcca |
281612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 258 - 305
Target Start/End: Complemental strand, 3936698 - 3936651
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||| ||||| |||| ||||||||| ||||||||||||||||| |
|
|
| T |
3936698 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcattgt |
3936651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 270 - 305
Target Start/End: Original strand, 9615490 - 9615525
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9615490 |
gtttgaactccggatcttacatatattatgcattgt |
9615525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 258 - 305
Target Start/End: Original strand, 17948126 - 17948173
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||| | |||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
17948126 |
gtggtggtcggggtttgaactccgaaccttacatattttatgcattgt |
17948173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 307
Target Start/End: Complemental strand, 37255009 - 37254970
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
37255009 |
gggttcgaaccccggaccttacatatattatgcattgtcc |
37254970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 258 - 305
Target Start/End: Original strand, 54857605 - 54857652
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||| |||||||||| ||||||||| ||||| ||||||||||| |
|
|
| T |
54857605 |
gtggtggccggggtttgaaccccggaccttgcatattttatgcattgt |
54857652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 307
Target Start/End: Complemental strand, 1757043 - 1756997
Alignment:
| Q |
261 |
gtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||| ||||||||||| |||||||| ||||| ||||||||||||| |
|
|
| T |
1757043 |
gtggccggggtttgaactacggaccttgcatattttatgcattgtcc |
1756997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 2587691 - 2587740
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
2587691 |
gtggtggctggggtttgaac-ccggaccttacatatattatgcattatcca |
2587740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 9783970 - 9783920
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
9783970 |
gtggtggccgaggtttgaacctcagaccttacatatattatgcattgtcca |
9783920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 9946498 - 9946448
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| | |||||||||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
9946498 |
gtggtggtcggggtttgaaccccggaccttgcatattttatgcattgtcca |
9946448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 307
Target Start/End: Original strand, 14197432 - 14197470
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
14197432 |
ggtttgaaccccggatcttacatatattatgcattgtcc |
14197470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 305
Target Start/End: Original strand, 19479468 - 19479514
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||| | |||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
19479468 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
19479514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 19588225 - 19588175
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| | ||||||| ||||| |||||||||||||| |
|
|
| T |
19588225 |
gtggtggccggggtttgaaccctggaccttgcatattttatgcattgtcca |
19588175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 21114295 - 21114345
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| | |||||||||| ||||||||| ||||||| |||||||||||| |
|
|
| T |
21114295 |
gtggtggtcggggtttgaaccccggaccttgcatatatcatgcattgtcca |
21114345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 305
Target Start/End: Original strand, 22164260 - 22164306
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||| | |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
22164260 |
tggtggtcggggtttgaaccccagaccttacatatattatgcattgt |
22164306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 270 - 308
Target Start/End: Complemental strand, 22411823 - 22411785
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
22411823 |
gtttgaaccccgaaccttacatatattatgcattgtcca |
22411785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 27537818 - 27537769
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||||||| |||| ||||| |||||||||||||||||||| |
|
|
| T |
27537818 |
gtggtggccggggtttgaattccg-accttgcatatattatgcattgtcca |
27537769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 28435238 - 28435288
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| |||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
28435238 |
gtggtggctggggtttgaaccccgaaccttgcatatattatgcattgtcca |
28435288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 278 - 308
Target Start/End: Complemental strand, 37462162 - 37462132
Alignment:
| Q |
278 |
tccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37462162 |
tccggaccttacatatattatgcattgtcca |
37462132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 270 - 308
Target Start/End: Complemental strand, 39146701 - 39146663
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
39146701 |
gtttgaactccgaaccttacttatattatgcattgtcca |
39146663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 307
Target Start/End: Complemental strand, 42861805 - 42861767
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
42861805 |
ggttcgaactccggaccttacatatgttatgcattgtcc |
42861767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 43034332 - 43034382
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| |||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
43034332 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcattgtcca |
43034382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 270 - 308
Target Start/End: Original strand, 49953405 - 49953443
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
49953405 |
gtttgaaccccggaccttgcatatattatgcattgtcca |
49953443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 4059226 - 4059275
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||| |||||| ||| ||||||||||||| |||||||||| |||||||| |
|
|
| T |
4059226 |
gtggttgcctggatttaaactccggaccttgcatatattatacattgtcc |
4059275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 8495058 - 8495009
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| || ||||||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
8495058 |
gtggtggccgggatttgaactcgggatcttgcatatattatgcattgtcc |
8495009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 308
Target Start/End: Original strand, 16304089 - 16304138
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| |||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
16304089 |
tggtggccgcggtttgaatcccggaccttgcatatattatgcattgtcca |
16304138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 303
Target Start/End: Original strand, 18903748 - 18903793
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcatt |
303 |
Q |
| |
|
||||||| | |||||||||| || |||||||||||||||||||||| |
|
|
| T |
18903748 |
gtggtggtcagggtttgaaccccagaccttacatatattatgcatt |
18903793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 267 - 308
Target Start/End: Complemental strand, 22040712 - 22040671
Alignment:
| Q |
267 |
tgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
22040712 |
tgggtttgaaccccgaaccttgcatatattatgcattgtcca |
22040671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 270 - 307
Target Start/End: Complemental strand, 23160099 - 23160062
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23160099 |
gtttgaacctcggaccttacatatattatgcattgtcc |
23160062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 270 - 307
Target Start/End: Original strand, 25783451 - 25783488
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
25783451 |
gtttgaaccccggaccttgcatatattatgcattgtcc |
25783488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 268 - 305
Target Start/End: Original strand, 32923203 - 32923240
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
32923203 |
gggtttgaaccccgaaccttacatatattatgcattgt |
32923240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 270 - 303
Target Start/End: Complemental strand, 36569232 - 36569199
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcatt |
303 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
36569232 |
gtttgaactccgaaccttacatatattatgcatt |
36569199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 37921817 - 37921768
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||| ||| ||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
37921817 |
gtggtagccggggtttgaatcccggaccttgcatatattatgcattgtcc |
37921768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 268 - 305
Target Start/End: Original strand, 40070968 - 40071005
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
40070968 |
gggtttgaacttcggaccttgcatatattatgcattgt |
40071005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 270 - 307
Target Start/End: Original strand, 40901139 - 40901176
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
40901139 |
gtttgaactcccgaccttgcatatattatgcattgtcc |
40901176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 271 - 308
Target Start/End: Complemental strand, 48159735 - 48159698
Alignment:
| Q |
271 |
tttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||| |
|
|
| T |
48159735 |
tttgaacttcgaaccttacatatattatgcattgtcca |
48159698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 50362129 - 50362178
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| ||||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
50362129 |
gtggtggccaaggtttgaaccctggaccttgcatatattatgcattgtcc |
50362178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 303
Target Start/End: Original strand, 54294412 - 54294457
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcatt |
303 |
Q |
| |
|
|||||| || |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
54294412 |
gtggtgtccggggtttgaaccccggaccttgcatatattatgcatt |
54294457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 306
Target Start/End: Complemental strand, 1737228 - 1737184
Alignment:
| Q |
262 |
tggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||| |||||||||||||| ||||| ||||| |||||||||||| |
|
|
| T |
1737228 |
tggccggggtttgaactccgaaccttgcatattttatgcattgtc |
1737184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 269 - 305
Target Start/End: Original strand, 7190449 - 7190485
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
7190449 |
ggttcgaactccggacgttacatatattatgcattgt |
7190485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 307
Target Start/End: Complemental strand, 13121614 - 13121566
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||| ||| ||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
13121614 |
tggtagccggggtttgaacttcagaccttgcatatattatgcattgtcc |
13121566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 270 - 306
Target Start/End: Original strand, 17423179 - 17423215
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
17423179 |
gtttgaaccccggaccttgcatatattatgcattgtc |
17423215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Original strand, 21991247 - 21991287
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||| |||||||||||||| ||||| |||||||||||||| |
|
|
| T |
21991247 |
gggttcgaactccggaccttgcatattttatgcattgtcca |
21991287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 306
Target Start/End: Original strand, 26593248 - 26593296
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatata-ttatgcattgtc |
306 |
Q |
| |
|
|||||||| ||||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
26593248 |
tggtggccggggtttgaactccggacattatatatagttatgcattgtc |
26593296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 308
Target Start/End: Complemental strand, 42139913 - 42139865
Alignment:
| Q |
260 |
ggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| |||||||||| |||||| || ||| |||||||||||||||| |
|
|
| T |
42139913 |
ggtggccggggtttgaaccccggacattgcatgtattatgcattgtcca |
42139865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Original strand, 43374272 - 43374312
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
43374272 |
gggtttgaactccgaaccttgcatattttatgcattgtcca |
43374312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 307
Target Start/End: Original strand, 48802425 - 48802473
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| ||| |||||| ||| |||||||||||||||| |||||||| |
|
|
| T |
48802425 |
tggtggccggggattgaaccccgaaccttacatatattattcattgtcc |
48802473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 49)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 3708764 - 3708715
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
3708764 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
3708715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 11868652 - 11868701
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
11868652 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
11868701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 29544698 - 29544649
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
29544698 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtcc |
29544649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 259 - 308
Target Start/End: Complemental strand, 34977274 - 34977225
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| |||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
34977274 |
tggtggccggggtttaaactccggaccttgcatatattatgcattgtcca |
34977225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 35360045 - 35360094
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
35360045 |
gtggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
35360094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 307
Target Start/End: Complemental strand, 28202358 - 28202319
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28202358 |
gggtttgaacttcggaccttacatatattatgcattgtcc |
28202319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 261 - 308
Target Start/End: Complemental strand, 42791363 - 42791316
Alignment:
| Q |
261 |
gtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
42791363 |
gtggccggggtttgaaccccggaccttgcatatattatgcattgtcca |
42791316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 25186232 - 25186282
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| |||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
25186232 |
gtggtggctggggtttgaaccccggaccttgcatatattatgcattgtcca |
25186282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 25625787 - 25625737
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
25625787 |
gtggtggtccgggtttgaaccccggaccttacatatattatgaattgtcca |
25625737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 33064057 - 33064007
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| | ||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
33064057 |
gtggtggccggagttcgaactccggaccttgcatatattatgcattgtcca |
33064007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 36359385 - 36359335
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
36359385 |
gtggtggccaaggtttgaaccccggaccttgcatatattatgcattgtcca |
36359335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 259 - 305
Target Start/End: Complemental strand, 41853435 - 41853389
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||||| ||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
41853435 |
tggtggccggggttcgaacgccggaccttacatatattatgcattgt |
41853389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 307
Target Start/End: Original strand, 44488011 - 44488049
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44488011 |
ggtttgaactccgaaccttacatatattatgcattgtcc |
44488049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 262 - 307
Target Start/End: Original strand, 4927443 - 4927488
Alignment:
| Q |
262 |
tggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
4927443 |
tggccggggtttgaaccccggaccttacatatattatgctttgtcc |
4927488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 10735821 - 10735870
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||| ||||||||| |||||||||||||| |||| |
|
|
| T |
10735821 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcatcgtcc |
10735870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 24592836 - 24592885
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| |||||||||| || |||||| ||||||||||||||||||| |
|
|
| T |
24592836 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtcc |
24592885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 27848229 - 27848184
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcatt |
303 |
Q |
| |
|
||||||||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
27848229 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
27848184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 31815877 - 31815926
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||| | |||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
31815877 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgcattgtcc |
31815926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 258 - 306
Target Start/End: Original strand, 4557761 - 4557809
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4557761 |
gtggtggtcagggtttgaaccacggaccttacatatattatgcattgtc |
4557809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 258 - 302
Target Start/End: Original strand, 15447704 - 15447748
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcat |
302 |
Q |
| |
|
||||||||| ||||||||||||| |||||| |||||||||||||| |
|
|
| T |
15447704 |
gtggtggccggggtttgaactccagaccttgcatatattatgcat |
15447748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 258 - 306
Target Start/End: Complemental strand, 17452702 - 17452654
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||||| |||||||||| || ||||||||||||||||| ||||||| |
|
|
| T |
17452702 |
gtggtggccagggtttgaaccccagaccttacatatattattcattgtc |
17452654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 307
Target Start/End: Complemental strand, 3904263 - 3904224
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
3904263 |
gggtttgaaccccagaccttacatatattatgcattgtcc |
3904224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 258 - 305
Target Start/End: Complemental strand, 20200776 - 20200729
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||| |||||||||| | ||||||| ||||||||||||||||| |
|
|
| T |
20200776 |
gtggtggccggggtttgaaccctggaccttgcatatattatgcattgt |
20200729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 307
Target Start/End: Original strand, 20565075 - 20565114
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
20565075 |
gggtttgaaccccggaccttgcatatattatgcattgtcc |
20565114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 2257042 - 2256992
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| ||||| |||| || |||||| |||||||||||||||||||| |
|
|
| T |
2257042 |
gtggtggccggggttcgaaccccagaccttgcatatattatgcattgtcca |
2256992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 267 - 305
Target Start/End: Complemental strand, 7537172 - 7537134
Alignment:
| Q |
267 |
tgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
7537172 |
tggggttgaactccggaccttgcatatattatgcattgt |
7537134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 270 - 308
Target Start/End: Original strand, 8091160 - 8091198
Alignment:
| Q |
270 |
gtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
8091160 |
gtttgaaccccggaccttgcatatattatgcattgtcca |
8091198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 307
Target Start/End: Complemental strand, 12124744 - 12124706
Alignment:
| Q |
269 |
ggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
12124744 |
ggttcgaactccggaccttgcatatattatgcattgtcc |
12124706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 271 - 305
Target Start/End: Original strand, 17842715 - 17842749
Alignment:
| Q |
271 |
tttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17842715 |
tttgaactccggatcttacatatattatgcattgt |
17842749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 278 - 308
Target Start/End: Complemental strand, 19043160 - 19043130
Alignment:
| Q |
278 |
tccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19043160 |
tccggaccttacatatattatgcattgtcca |
19043130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 20455962 - 20455912
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| || || |||| ||||||||| |||||||||||||||||||| |
|
|
| T |
20455962 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattgtcca |
20455912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 23407008 - 23407058
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||| | |||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
23407008 |
gtggtggtcagggtttgaaccccagaccttgcatatattatgcattgtcca |
23407058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 24579658 - 24579708
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| | |||||||| | ||||||| |||||||||||||||||||| |
|
|
| T |
24579658 |
gtggtggccagagtttgaaccctggaccttgcatatattatgcattgtcca |
24579708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 278 - 308
Target Start/End: Original strand, 39836719 - 39836749
Alignment:
| Q |
278 |
tccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39836719 |
tccggaccttacatatattatgcattgtcca |
39836749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 258 - 308
Target Start/End: Original strand, 43004672 - 43004722
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
||||||||| || |||||| | |||||||| |||||||||||||||||||| |
|
|
| T |
43004672 |
gtggtggccaggatttgaatttcggaccttgcatatattatgcattgtcca |
43004722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 308
Target Start/End: Original strand, 660813 - 660862
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||| | |||||||||| | ||||||| |||||||||||||||||||| |
|
|
| T |
660813 |
tggtggtcggggtttgaaccctggaccttgcatatattatgcattgtcca |
660862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 274 - 307
Target Start/End: Complemental strand, 4056845 - 4056812
Alignment:
| Q |
274 |
gaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
4056845 |
gaactccggaccttgcatatattatgcattgtcc |
4056812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 307
Target Start/End: Complemental strand, 5028923 - 5028878
Alignment:
| Q |
262 |
tggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||| |||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
5028923 |
tggccggggtttgaaccccaaaccttacatatattatgcattgtcc |
5028878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 306
Target Start/End: Complemental strand, 22709153 - 22709108
Alignment:
| Q |
261 |
gtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
|||||| |||||||||| ||||||||| ||||| |||||||||||| |
|
|
| T |
22709153 |
gtggccggggtttgaaccccggaccttgcatattttatgcattgtc |
22709108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 35820291 - 35820340
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| ||||||||| ||||||||| ||| ||||||||||||||| |
|
|
| T |
35820291 |
gtggtggccgaggtttgaaccccggaccttgcatgtattatgcattgtcc |
35820340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 308
Target Start/End: Original strand, 41542974 - 41543023
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| ||||| ||| ||| |||||||||||||||||||||||||| |
|
|
| T |
41542974 |
tggtggccgaggtttaaaccccgaaccttacatatattatgcattgtcca |
41543023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 308
Target Start/End: Complemental strand, 41859922 - 41859873
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| |||||||||| || |||||| ||||| |||||||||||||| |
|
|
| T |
41859922 |
tggtggccggggtttgaaccccagaccttgcatattttatgcattgtcca |
41859873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 308
Target Start/End: Complemental strand, 44526198 - 44526149
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||| ||||||||| ||||||||| | |||||||||||||||||| |
|
|
| T |
44526198 |
tggtggccggggtttgaatcccggaccttgcgtatattatgcattgtcca |
44526149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Original strand, 8781650 - 8781690
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| ||||||||| |||| ||||||||||||||| |
|
|
| T |
8781650 |
gggtttgaaccccggaccttgcatacattatgcattgtcca |
8781690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 306
Target Start/End: Original strand, 27412826 - 27412874
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||||| | |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
27412826 |
gtggtggtcggggtttgaacaacagaccttacatatattatgcattgtc |
27412874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 29734752 - 29734712
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
29734752 |
gggtttgaaccacggaccttgcatatattatgcattgtcca |
29734712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 307
Target Start/End: Complemental strand, 30089119 - 30089071
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| ||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
30089119 |
tggtggccgaggtttgaaccccggaccttgtatatattatgcattgtcc |
30089071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 307
Target Start/End: Complemental strand, 30125723 - 30125675
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| ||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
30125723 |
tggtggccgaggtttgaaccccggaccttgtatatattatgcattgtcc |
30125675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 268 - 308
Target Start/End: Complemental strand, 31543073 - 31543033
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgtcca |
308 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||| |||| |
|
|
| T |
31543073 |
gggtttgaaccccggaccttgcatatattatgcattatcca |
31543033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 262 - 307
Target Start/End: Complemental strand, 239874 - 239829
Alignment:
| Q |
262 |
tggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||| ||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
239874 |
tggccggggtttgaactccggactttgcatatattatgcattgtcc |
239829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 259 - 306
Target Start/End: Original strand, 189963 - 190010
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtc |
306 |
Q |
| |
|
||||| || |||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
189963 |
tggtgaccagggtttgaaccccgaaccttacatatattatgcattgtc |
190010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 305
Target Start/End: Complemental strand, 118888 - 118843
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
118888 |
tggtggcc-gggtttgaactccagaccttacatattttatgcattgt |
118843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1127 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold1127
Description:
Target: scaffold1127; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 268 - 305
Target Start/End: Original strand, 1165 - 1202
Alignment:
| Q |
268 |
gggtttgaactccggaccttacatatattatgcattgt |
305 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
1165 |
gggtttgaaccccggaccttgcatatattatgcattgt |
1202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Original strand, 31912 - 31961
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| | || ||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
31912 |
gtggtggccggagtgtgaaccccggaccttgcatatattatgcattgtcc |
31961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 303
Target Start/End: Original strand, 61560 - 61605
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcatt |
303 |
Q |
| |
|
||||||||| |||||||||| | |||||||||||| |||||||||| |
|
|
| T |
61560 |
gtggtggccggggtttgaaccctggaccttacatacattatgcatt |
61605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 258 - 307
Target Start/End: Complemental strand, 75396 - 75347
Alignment:
| Q |
258 |
gtggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
||||||||| || || |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
75396 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattgtcc |
75347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0524 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0524
Description:
Target: scaffold0524; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 307
Target Start/End: Complemental strand, 1304 - 1256
Alignment:
| Q |
259 |
tggtggcctgggtttgaactccggaccttacatatattatgcattgtcc |
307 |
Q |
| |
|
|||||||| || ||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
1304 |
tggtggccgggatttgaaccccggaccttatatagattatgcattgtcc |
1256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University