View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15937_high_21 (Length: 285)
Name: NF15937_high_21
Description: NF15937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15937_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 4186078 - 4185810
Alignment:
| Q |
1 |
gtgtttgctgctttcagc-tttttgtagaggtaagtagagaaaatgtagtgtgcatggacaaataggcacgacgcacaactctctccggaggccgaagga |
99 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4186078 |
gtgtttgctgctttcagcctttttgtagaggtaagtagagaaaatgtagtgtgcatggacaaataggcacgacgcacaactctctccggaggccgaagga |
4185979 |
T |
 |
| Q |
100 |
gtgctcctctcgtcttgaagtcataatctaatccccaggccttcacatttttgtgactgatccttgaagtcatattctaattagagggaaagactaactt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4185978 |
gtgctcctctcgtcttgaagtcataatctaatccccaggccttcacatttttgtgactgatccttgaagtc--attctaattagagggaaagactaactt |
4185881 |
T |
 |
| Q |
200 |
atttttctaatctatatatatagaactcaaaagaaataaaacaagttgtctgcgaagaagataagggtgat |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4185880 |
atttttctaatctatatatatagaactcaaaagaaataaaacaagttgtctgcgaagaagataagggtgat |
4185810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University