View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15937_high_30 (Length: 236)
Name: NF15937_high_30
Description: NF15937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15937_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 31034856 - 31035076
Alignment:
| Q |
1 |
attatgggttcttcaatttcagaggaagttgttgttgtgagttcgattgagagatggatgatgtatggtgatggaaagaggttgtggtgaggttgttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31034856 |
attatgggttcttcaatttcagaggaagttgttgttgtgagttcgattgagagatggatgatgtatggtgatggaaagaggttgtggtgaggttgttgat |
31034955 |
T |
 |
| Q |
101 |
ggtgtgtggaccgtgtaatttttccatatttgtgttgaagataaagaatggtaatttcatctggagagagaaaggctttcactcgattgaagatttgttg |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31034956 |
ggtgtgtggaccgtgtaattttttcatatttgtgttgaagataaagaagggtaatttcatccggagagagaaaggctttcactcgattgaagatttgttg |
31035055 |
T |
 |
| Q |
201 |
ttgttgtgagtgtgtagttaa |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31035056 |
ttgttgtgagtgtgtagttaa |
31035076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 66 - 221
Target Start/End: Original strand, 31027961 - 31028114
Alignment:
| Q |
66 |
tggtgatggaaagaggttgtggtgaggttgttgatggtgtgtggaccgtgtaatttttccatatttgtgttgaagataaagaatggtaatttcatctgga |
165 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
31027961 |
tggtgatggaaataggttgtggtgaggttgttgatggtgtgtggaccacgtaatttttccatatttgtgttgaagataaagaattgtaatttcatccg-- |
31028058 |
T |
 |
| Q |
166 |
gagagaaaggctttcactcgattgaagatttgttgttgttgtgagtgtgtagttaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31028059 |
gagagaaaggctttcactcgattgaagatttgttgttgttgtgagtgtgtagttaa |
31028114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 31 - 221
Target Start/End: Complemental strand, 13435442 - 13435258
Alignment:
| Q |
31 |
gttgttgtgagttcgattgagagatggatgatgtatggtgatggaaagaggttgtggtgaggttgttgatggtgtgtggaccgtgtaat-ttttccatat |
129 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
13435442 |
gttgttgtcaattcgattgagagatggatgatgt-tggtgatggaa-gaggttgtggtgaggttgttgatggtgtgtggaccgtgtaattttttccagat |
13435345 |
T |
 |
| Q |
130 |
ttgtgttgaagataaagaatggtaatttcatctggagagagaaaggctttcactcgattgaagatttgttgttgttgtgagtgtgtagttaa |
221 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| |||| |||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13435344 |
ttgtgttgaagataaagaagggtaattttatc--cagaggaaaagactttcactcgattgaaga---attgttgttgtgagtgtgtagttaa |
13435258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University