View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15937_low_28 (Length: 251)
Name: NF15937_low_28
Description: NF15937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15937_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 18829659 - 18829836
Alignment:
| Q |
1 |
cttcaaatgatcttcgagaatgagatcgattcagaagacgatcttcaagatcttctccggtgttttcttcatctcaattctagttgttatcatggtgtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18829659 |
cttcaaatgatcttcgagaatgagatcgattcagaagacgatcttcaagatcttctccggtgttttcttcatctcaattctagttgttatcatggtgtta |
18829758 |
T |
 |
| Q |
101 |
tcgtaaaagtcttcaatgatatatgtcatgaagctttccccgacaaggttggtagcactactataaaaccttccgggt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18829759 |
tcgtaaaagtcttcaatgatatatgtcatgaagctttccccgacaaggttggtagcactactataaaaccttccgggt |
18829836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 18837726 - 18837590
Alignment:
| Q |
1 |
cttcaaatgatcttcgagaatgagatcgattcagaagacgatcttcaagatcttctccggtgttttcttcatctcaattctagttgttatcatggtgtta |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || || ||||||| || |||||| ||||||||||||||||||||| || ||||||||| ||| | |
|
|
| T |
18837726 |
cttcaaatgatcttcgaggatgagatcgattcggaggatgatcttcgagttcttcttcggtgttttcttcatctcaatgatacttgttatcaccttgtca |
18837627 |
T |
 |
| Q |
101 |
tcgtaaaagtcttcaatgatatatgtcatgaagcttt |
137 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
18837626 |
tcgttaaagtctttaatgatatatgtcatgaagcttt |
18837590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University