View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15937_low_34 (Length: 235)
Name: NF15937_low_34
Description: NF15937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15937_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 217
Target Start/End: Original strand, 44706935 - 44707136
Alignment:
| Q |
16 |
ataggtaattggtcttgatagagtactttgaatccatatagaggtacatttataaaaataaaaatgactaacatccaatagttaatgaggtaaatggaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44706935 |
ataggtaattggtcttgatagagtactttgaatgcatgtagaggtacatttataaaaataaaaatgactaacatccaatagttaatgaggtaaatggaat |
44707034 |
T |
 |
| Q |
116 |
gatctaggtgtacacgtaattagtctagatagactattttgataatccatataggatatagtgtttgctatatcaaatgtttgtgcatatgaccaactta |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44707035 |
gatctaggtgtacacgtaattagtctagatagactattttgataatccatataggatatagtgtttgctatatcaaatgtttgtgcataagaccaactta |
44707134 |
T |
 |
| Q |
216 |
at |
217 |
Q |
| |
|
|| |
|
|
| T |
44707135 |
at |
44707136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University