View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15937_low_37 (Length: 215)

Name: NF15937_low_37
Description: NF15937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15937_low_37
NF15937_low_37
[»] chr6 (1 HSPs)
chr6 (16-201)||(5543030-5543215)


Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 201
Target Start/End: Original strand, 5543030 - 5543215
Alignment:
16 caaattgaagtgattaagtgtaaattaacatgaaggaaataaagtaatcaagaaataaagtatactgcaaattaaacagcaaagcaatgaacgatggaaa 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5543030 caaattgaagtgattaagtgtaaattaacatgaaggaaataaagtaatcaagaaataaagtatactgcaaattaaacagcaaagcaatgaacgatggaaa 5543129  T
116 gtacaatataaattgtgtgcgacacaaagtttctggactttctatggtaaagaacagagaaaataaacaagcaaatattttgttca 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5543130 gtacaatataaattgtgtgcgacacaaagtttctggactttctatggtaaagaacagagaaaataaacaagcaaatattttgttca 5543215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University