View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15937_low_38 (Length: 211)
Name: NF15937_low_38
Description: NF15937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15937_low_38 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 4 - 211
Target Start/End: Original strand, 39777934 - 39778141
Alignment:
| Q |
4 |
taacttttttataccaaactaaccaaatttttgaacctagaacatgcttaggttttgagccattgatttcttgactctcaagtaattaactggttttaaa |
103 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39777934 |
taacttttttatgccaaactaaccatatttttgaacctaaaacctgcttagcttttgagccattgatttcttgactctcaagtaattaactggttttaaa |
39778033 |
T |
 |
| Q |
104 |
ccaaatattacgctaacataactcattcaactgtaatgttataaggaacaaaacatacctcctgaagcaaagcaccattagctgtatcaaaaacacgaaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39778034 |
ccaaatattacgctaacataactcattcaactgtaatattataaggaacaaaacatacctcctgaagcaaagcaccattagctgtatcaaaaacacgaat |
39778133 |
T |
 |
| Q |
204 |
gagcgtgc |
211 |
Q |
| |
|
|||||||| |
|
|
| T |
39778134 |
gagcgtgc |
39778141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University