View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15938_high_15 (Length: 344)
Name: NF15938_high_15
Description: NF15938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15938_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 55088744 - 55088936
Alignment:
| Q |
18 |
tatagatgatgcaataaggttaaaaaacatagcaatgctaaatgcatcagcaattaat---cacacatccatgcatatacatatgcccctcctctctttc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55088744 |
tatagatgatgcaataaggttaaaaaacatagcaatgctaaatgcatcagcaattaataatcacacatccatgcatatacatatgcccctcctctctttc |
55088843 |
T |
 |
| Q |
115 |
tgcctctattagcaagttaattgacattattggtttagatgataactcacgcacgtggactaggtggtactaactactaaggctcttcttctt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55088844 |
tgcctctattagcaagttaattgacattattggtttagatgataactcacgcacgtggactaggtggtactaactactaaggctcttcttctt |
55088936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 234 - 330
Target Start/End: Original strand, 55089238 - 55089334
Alignment:
| Q |
234 |
aggtttgtgcaataatgcggataaatctctaaggtcaacnnnnnnnngtccgtctgtctcaaactttattgtatctttttgatgttgaaacttgcag |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55089238 |
aggtttgtgcaataatgcggataaatctctaaggtcaacgtattcttgtccgtctgtctcaaactttattgtatctttttgatgttgaaacttgcag |
55089334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University