View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15938_high_9 (Length: 452)
Name: NF15938_high_9
Description: NF15938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15938_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 17 - 441
Target Start/End: Complemental strand, 38609820 - 38609397
Alignment:
| Q |
17 |
atttgctttattaacttgttttactcatttatctgtcattgatattcatctgcattgtttgaannnnnnnagttcagaaaggatgatgataaattgataa |
116 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38609820 |
atttgcattattaacttgtttttctcatttatttgtcattgatattcatctgcatt-tttgaatttttttagttcagaaaggatgatgataaattgataa |
38609722 |
T |
 |
| Q |
117 |
ttgattttgtgatgtttacctttattcacatgcttatatgttttattagaggaactttacgaaaaatttcacaaacaggttgatattgtcttcgtatgca |
216 |
Q |
| |
|
||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38609721 |
ttggtcttgtgatgtttacctttattcgcatgcttatatgttttattagaggaactttacgaaaaatttcacaaacaggttgatattgtcttcgtatgca |
38609622 |
T |
 |
| Q |
217 |
tttttgaaaaactgctttaatttgttgattctttgtatttttcaaaaatatcgtatgtaacttgtttgccaagaatatcgtatgtaacttgtttgtcata |
316 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38609621 |
tttttgaaaaactgccttaatttgttgattctttgtatttttcaaaaatatcgtatgtaacttgtttgccaaaaatatcgtatgtaacttgtttgtcact |
38609522 |
T |
 |
| Q |
317 |
ttaccttttttacatttatgaatgcactaatcatgtctcacagggcccaaaaatacatgcggagatccacaaaaatgggcatgggcttggtcaggtgagt |
416 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38609521 |
ataccttttttacatttatgaatgcactaatcatgtctcacagggcccaaaaatacatgcggagatccacaaaaatgggcatgggcttggtcaggtgagt |
38609422 |
T |
 |
| Q |
417 |
cgtggaggatcctctgctacttcaa |
441 |
Q |
| |
|
| ||||||||| ||||||||||||| |
|
|
| T |
38609421 |
catggaggatcatctgctacttcaa |
38609397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University