View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15938_low_20 (Length: 334)
Name: NF15938_low_20
Description: NF15938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15938_low_20 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 16 - 334
Target Start/End: Complemental strand, 33633583 - 33633264
Alignment:
| Q |
16 |
atcatgccaaaggaatatttttaatgtaatccgcaatgagatgattggaaacaacatgcttagattaacccaaatggaatagtaactttgagaattctat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33633583 |
atcatgccaaaggaatatttttaatgtaatccgcaatgagatgattggaaacaacatgcttagattaacccaaatggaatagtaactttgagtgttctat |
33633484 |
T |
|
| Q |
116 |
gatgggatttagggcagatgtaacgnnnnnnnn-ctgtttattattacaacattgtccttactacaccaaagattatcattcgcatggactctaccaaca |
214 |
Q |
| |
|
|| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33633483 |
gacgggatttagggcagatgtaacgtttttttttctgtttattattacaacattgtccttactacaccaaagattatcattcgcatggactctactaaca |
33633384 |
T |
|
| Q |
215 |
atttatttattttttgacaaaactctaataacattttgtgtagcccttttaacaatttgcatggataattggattatatatagacgtaagtgtattatta |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33633383 |
atttatttattttttgacaaaactctaataacattttgtgtagcccttttaacaatttgcatggataattggattatatatagacgtaagtgtattatta |
33633284 |
T |
|
| Q |
315 |
tactgattgagaaagatttt |
334 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33633283 |
tactgattgagaaagatttt |
33633264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University