View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15938_low_31 (Length: 288)
Name: NF15938_low_31
Description: NF15938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15938_low_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 19 - 257
Target Start/End: Original strand, 2844303 - 2844537
Alignment:
| Q |
19 |
atggataactctactctaccgatcttttgtatatgaataaacnnnnnnnttgcct-atattatattacttgtttacgcaaatttgacattaattgtttaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| | |||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2844303 |
atggataactctactctaccgatctttggtatatgtacaaacaaaaaatttgcctaatattatattacttgtttacgcaaatttgacattaattgtttaa |
2844402 |
T |
 |
| Q |
118 |
tttatactctagcgatgttacccgatagaagaatacaaatgctaaaggatgattcttctgatgttaacattctgtcatctaatatttaagcatgccacaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
2844403 |
tttatactctagcgatgttacccgatagaagaatacaaatgctaaaggatga---ttctgatgttaacattctatcatctaatatttaagcatgc--caa |
2844497 |
T |
 |
| Q |
218 |
ctcttatgnnnnnnnaatgaaagttgagcatgctaacttt |
257 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
2844498 |
ctcttatgtttttttaatgaaagttgagcatgctaacttt |
2844537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University